AT1G02210
NAC Family

NAC domain-containing protein

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
N/A
Physical Location & Seq
Reverse (-)
427548 .. 427811
264 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G02210.1

Sequence Viewer

Length: 264 bp
ATGGTATGGTTCTTCTTTAGTTGTGATGAATATAACGAAGAAATATTGAAAACGAATTCGGGTTATTGGAAAGAAACTGTATCCAACACACCAATCATTGGCAAGTGGATAACTAGTAATGGTGTTAAAATTGGTGAGAAACAAGTTTTGGTTTTCCAATCGTATGAAAACATCAATGGATCCAAATCCGATTGGGTAATGCACGTGTATCAACCAACGTTTTTGCCTCCTAATCAGGTAATATTCCGAATTTATGATGTTTAA

Protein Analysis

87

Amino Acids

10.25

Weight (kDa)

5.19

Isoelectric Point (pI)

36.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAM PF02365 2 - 71 4e-11 No apical meristem (NAM) protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 98
AclI AACGTT 1 cut(s) 218
AclWI GGATC 2 cut(s) 174, 187
AcsI RAATTY 2 cut(s) 55, 249
AcvI CACGTG 1 cut(s) 205
AfiI CCNNNNNNNGG 1 cut(s) 98
AflIII ACRYGT 1 cut(s) 204
AgsI TTSAA 1 cut(s) 49
AhlI ACTAGT 1 cut(s) 113
AjuI GAANNNNNNNTTGG 2 cut(s) 131, 163
AlwI GGATC 2 cut(s) 174, 187
ApoI RAATTY 2 cut(s) 55, 249
AsuHPI GGTGA 1 cut(s) 146
BamHI GGATCC 1 cut(s) 179
BbrPI CACGTG 1 cut(s) 205
BciVI GTATCC 1 cut(s) 91
BcuI ACTAGT 1 cut(s) 113
BfaI CTAG 1 cut(s) 114
BfuI GTATCC 1 cut(s) 91
BmiI GGNNCC 1 cut(s) 181
BsaAI YACGTR 1 cut(s) 205
BsaBI GATNNNNATC 1 cut(s) 184
Bsc4I CCNNNNNNNGG 1 cut(s) 98
Bse8I GATNNNNATC 1 cut(s) 184
BseJI GATNNNNATC 1 cut(s) 184
BseLI CCNNNNNNNGG 1 cut(s) 98
BslI CCNNNNNNNGG 1 cut(s) 98
Bsp143I GATC 1 cut(s) 179
BspLI GGNNCC 1 cut(s) 181
BspPI GGATC 2 cut(s) 174, 187
BssMI GATC 1 cut(s) 179
Bst4CI ACNGT 1 cut(s) 79
BstBAI YACGTR 1 cut(s) 205
BstKTI GATC 1 cut(s) 182
BstMBI GATC 1 cut(s) 179
BstX2I RGATCY 1 cut(s) 179
BstYI RGATCY 1 cut(s) 179
BsuI GTATCC 1 cut(s) 91
DpnI GATC 1 cut(s) 181
DpnII GATC 1 cut(s) 179
Eco72I CACGTG 1 cut(s) 205
EcoRI GAATTC 1 cut(s) 55
FaiI YATR 4 cut(s) 7, 33, 165, 255
FspBI CTAG 1 cut(s) 114
HphI GGTGA 1 cut(s) 146
Hpy188I TCNGA 2 cut(s) 190, 248
HpyCH4III ACNGT 1 cut(s) 79
HpyCH4IV ACGT 2 cut(s) 204, 218
HpyCH4V TGCA 1 cut(s) 202
HpySE526I ACGT 2 cut(s) 204, 218
Kzo9I GATC 1 cut(s) 179
LpnPI CCDG 1 cut(s) 221
MaeI CTAG 1 cut(s) 114
MaeII ACGT 2 cut(s) 204, 218
MalI GATC 1 cut(s) 181
MboI GATC 1 cut(s) 179
MboII GAAGA 2 cut(s) 4, 50
MflI RGATCY 1 cut(s) 179
MluCI AATT 3 cut(s) 55, 129, 249
MmeI TCCRAC 1 cut(s) 108
MnlI CCTC 1 cut(s) 237
MseI TTAA 2 cut(s) 126, 262
NdeII GATC 1 cut(s) 179
NlaIV GGNNCC 1 cut(s) 181
PflMI CCANNNNNTGG 1 cut(s) 98
PmaCI CACGTG 1 cut(s) 205
PmlI CACGTG 1 cut(s) 205
Ppu21I YACGTR 1 cut(s) 205
Psp1406I AACGTT 1 cut(s) 218
PspCI CACGTG 1 cut(s) 205
PspN4I GGNNCC 1 cut(s) 181
PsuI RGATCY 1 cut(s) 179
SaqAI TTAA 2 cut(s) 126, 262
Sau3AI GATC 1 cut(s) 179
SetI ASST 3 cut(s) 207, 221, 240
SgeI CNNG 7 cut(s) 72, 115, 126, 155, 215, 217, 248
SpeI ACTAGT 1 cut(s) 113
Sse9I AATT 3 cut(s) 55, 129, 249
SspI AATATT 2 cut(s) 45, 243
SspMI CTAG 1 cut(s) 114
TaaI ACNGT 1 cut(s) 79
TaiI ACGT 2 cut(s) 207, 221
TasI AATT 3 cut(s) 55, 129, 249
Tru1I TTAA 2 cut(s) 126, 262
Tru9I TTAA 2 cut(s) 126, 262
TspDTI ATGAA 2 cut(s) 42, 180
Van91I CCANNNNNTGG 1 cut(s) 98
XapI RAATTY 2 cut(s) 55, 249
XspI CTAG 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.