FvH4_2g01850
HSP70 Family

heat shock protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
N/A
Physical Location & Seq
Reverse (-)
1587892 .. 1588164
273 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g01850.t1

Sequence Viewer

Length: 231 bp
ATGCCCTCAAAATTTAACGGTGTTAATGGTCAGGGGTATCAAAATGCTAACGGAATGAAACTTCGGAATGAAACAAAGCAATTAGCACCAAAGGAAATATCATCAATGGTTCTCTCTAAGATGCGTGAAATAGTGGAAATGTATCTTGGATCGGTAGTAAAGAATGCAGTAGTAACTGTCCCAACATATTTTATTGACTCTAACGACATGCTACAAAGGACGCTGGTTTAA

Protein Analysis

77

Amino Acids

8.51

Weight (kDa)

9.45

Isoelectric Point (pI)

40.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP70 PF00012 15 - 68 4.6e-14 Hsp70 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 157
AcsI RAATTY 1 cut(s) 11
AjuI GAANNNNNNNTTGG 2 cut(s) 129, 161
AlwI GGATC 1 cut(s) 157
ApoI RAATTY 1 cut(s) 11
BmsI GCATC 1 cut(s) 111
BslFI GGGAC 1 cut(s) 164
BsmFI GGGAC 1 cut(s) 164
BsmI GAATGC 1 cut(s) 169
Bsp143I GATC 1 cut(s) 149
BspPI GGATC 1 cut(s) 157
BssMI GATC 1 cut(s) 149
Bst4CI ACNGT 2 cut(s) 20, 178
BstDEI CTNAG 1 cut(s) 117
BstKTI GATC 1 cut(s) 152
BstMBI GATC 1 cut(s) 149
BstNSI RCATGY 1 cut(s) 211
CviAII CATG 1 cut(s) 208
DdeI CTNAG 1 cut(s) 117
DpnI GATC 1 cut(s) 151
DpnII GATC 1 cut(s) 149
FaeI CATG 1 cut(s) 211
FaiI YATR 2 cut(s) 187, 209
FaqI GGGAC 1 cut(s) 164
FatI CATG 1 cut(s) 207
Hin1II CATG 1 cut(s) 211
HinfI GANTC 1 cut(s) 197
Hpy188I TCNGA 1 cut(s) 66
HpyCH4III ACNGT 2 cut(s) 20, 178
HpyCH4V TGCA 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 117
Hsp92II CATG 1 cut(s) 211
Kzo9I GATC 1 cut(s) 149
LpnPI CCDG 2 cut(s) 17, 209
LweI GCATC 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 172
MalI GATC 1 cut(s) 151
MboI GATC 1 cut(s) 149
MluCI AATT 2 cut(s) 11, 80
MlyI GAGTC 1 cut(s) 191
MnlI CCTC 1 cut(s) 16
MseI TTAA 3 cut(s) 15, 24, 229
Mva1269I GAATGC 1 cut(s) 169
NdeII GATC 1 cut(s) 149
NlaIII CATG 1 cut(s) 211
NspI RCATGY 1 cut(s) 211
PctI GAATGC 1 cut(s) 169
PleI GAGTC 1 cut(s) 191
PpsI GAGTC 1 cut(s) 191
SaqAI TTAA 3 cut(s) 15, 24, 229
Sau3AI GATC 1 cut(s) 149
SchI GAGTC 1 cut(s) 191
SfaNI GCATC 1 cut(s) 111
SgeI CNNG 4 cut(s) 44, 137, 158, 220
Sse9I AATT 2 cut(s) 11, 80
TaaI ACNGT 2 cut(s) 20, 178
TasI AATT 2 cut(s) 11, 80
Tru1I TTAA 3 cut(s) 15, 24, 229
Tru9I TTAA 3 cut(s) 15, 24, 229
TspDTI ATGAA 2 cut(s) 71, 84
TspGWI ACGGA 1 cut(s) 66
XapI RAATTY 1 cut(s) 11
XceI RCATGY 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.