Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb6

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

22104098 .. 22105980

Gene Structure 1883 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_6g28660.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 432 bp

ATGGCCTCATCAACCCCTTCGCCTCTTTCAAAAGTTGAACTCAATCAAAAAGTCAAACGCCCTCAACGAGTCTCCGAAATACGATGCCCAGATCGAAACCCGATCTCCTGGATCGATCTTCGACGCCGAAACGCCTCCAATCTGCAATATGAACCCGACAGAAAACCGATCTCCCAGAGATTCCGCCCAAGCTCTCTTCGATCCCGGCGTCGCCGTCCGCACCCGGGACTCTGCCTCCCCCACAGACGAGGGACTGTGCAAAGGTCGTGGCTGAGTTCTCCTCCGTCGCCGCCCTCGTTACTCTCTGAACCACCCAAGACGATCATGATGGTTATGGGTGTGAAAGGTCTCACACTTTACCACCTCAAGAACCACCACCAGGTTAATTGTTGCTCTCTGCAACATTTTTTGAAACTTACTTTTCTTTTCTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_CC_LHEQLE Myb_DNA-binding

Protein Analysis

144

Amino Acids

16.62

Weight (kDa)

11.5

Isoelectric Point (pI)

84.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	3 cut(s)	184, 218, 290
AclWI	GGATC	2 cut(s)	119, 195
AcyI	GRCGYC	2 cut(s)	124, 208
AfiI	CCNNNNNNNGG	2 cut(s)	224, 379
AgsI	TTSAA	3 cut(s)	30, 38, 412
AjnI	CCWGG	2 cut(s)	107, 378
AluBI	AGCT	1 cut(s)	192
AluI	AGCT	1 cut(s)	192
Alw26I	GTCTC	2 cut(s)	76, 353
AlwI	GGATC	2 cut(s)	119, 195
Ama87I	CYCGRG	1 cut(s)	223
AoxI	GGCC	1 cut(s)	3
AsuC2I	CCSGG	3 cut(s)	205, 224, 225
AvaI	CYCGRG	1 cut(s)	223
BccI	CCATC	1 cut(s)	322
BceAI	ACGGC	1 cut(s)	198
BciT130I	CCWGG	2 cut(s)	109, 380
BcnI	CCSGG	3 cut(s)	205, 224, 225
BcoDI	GTCTC	2 cut(s)	76, 353
BisI	GCNGC	1 cut(s)	290
BlsI	GCNGC	1 cut(s)	291
Bme1390I	CCNGG	5 cut(s)	109, 205, 224, 225, 380
BmeT110I	CYCGRG	1 cut(s)	223
BmrFI	CCNGG	5 cut(s)	109, 205, 224, 225, 380
BmsI	GCATC	1 cut(s)	74
BplI	GAGNNNNNCTC	2 cut(s)	265, 297
BpuEI	CTTGAG	1 cut(s)	350
BpuMI	CCSGG	3 cut(s)	205, 224, 225
Bsa29I	ATCGAT	1 cut(s)	114
BsaHI	GRCGYC	2 cut(s)	124, 208
BsaI	GGTCTC	1 cut(s)	353
BsaJI	CCNNGG	1 cut(s)	223
BsaXI	ACNNNNNCTCC	4 cut(s)	89, 119, 219, 249
Bsc4I	CCNNNNNNNGG	2 cut(s)	224, 379
BseBI	CCWGG	2 cut(s)	109, 380
BseCI	ATCGAT	1 cut(s)	114
BseDI	CCNNGG	1 cut(s)	223
BseLI	CCNNNNNNNGG	2 cut(s)	224, 379
BseMII	CTCAG	1 cut(s)	263
BseRI	GAGGAG	1 cut(s)	270
BshFI	GGCC	1 cut(s)	5
BshVI	ATCGAT	1 cut(s)	114
BsiHKCI	CYCGRG	1 cut(s)	223
BsiSI	CCGG	2 cut(s)	205, 224
BslFI	GGGAC	2 cut(s)	240, 265
BslI	CCNNNNNNNGG	2 cut(s)	224, 379
BsmAI	GTCTC	2 cut(s)	76, 353
BsmFI	GGGAC	2 cut(s)	240, 265
BsnI	GGCC	1 cut(s)	5
Bso31I	GGTCTC	1 cut(s)	353
BsoBI	CYCGRG	1 cut(s)	223
Bsp143I	GATC	7 cut(s)	91, 102, 111, 115, 168, 200, 321
BspACI	CCGC	3 cut(s)	184, 218, 290
BspANI	GGCC	1 cut(s)	5
BspCNI	CTCAG	1 cut(s)	264
BspDI	ATCGAT	1 cut(s)	114
BspHI	TCATGA	1 cut(s)	324
BspPI	GGATC	2 cut(s)	119, 195
BspTNI	GGTCTC	1 cut(s)	353
BssECI	CCNNGG	1 cut(s)	223
BssMI	GATC	7 cut(s)	91, 102, 111, 115, 168, 200, 321
BssNI	GRCGYC	2 cut(s)	124, 208
Bst2UI	CCWGG	2 cut(s)	109, 380
Bst4CI	ACNGT	1 cut(s)	256
Bst6I	CTCTTC	1 cut(s)	201
BstACI	GRCGYC	2 cut(s)	124, 208
BstDEI	CTNAG	1 cut(s)	272
BstKTI	GATC	7 cut(s)	94, 105, 114, 118, 171, 203, 324
BstMAI	GTCTC	2 cut(s)	76, 353
BstMBI	GATC	7 cut(s)	91, 102, 111, 115, 168, 200, 321
BstNI	CCWGG	2 cut(s)	109, 380
BstSCI	CCNGG	5 cut(s)	107, 203, 222, 223, 378
Bsu15I	ATCGAT	1 cut(s)	114
BsuRI	GGCC	1 cut(s)	5
BsuTUI	ATCGAT	1 cut(s)	114
CciI	TCATGA	1 cut(s)	324
Cfr9I	CCCGGG	1 cut(s)	223
ClaI	ATCGAT	1 cut(s)	114
CseI	GACGC	2 cut(s)	132, 197
CsiI	ACCWGGT	1 cut(s)	378
CspCI	CAANNNNNGTGG	2 cut(s)	248, 283
CviAII	CATG	1 cut(s)	325
CviJI	RGCY	3 cut(s)	5, 192, 271
CviKI_1	RGCY	3 cut(s)	5, 192, 271
DdeI	CTNAG	1 cut(s)	272
DpnI	GATC	7 cut(s)	93, 104, 113, 117, 170, 202, 323
DpnII	GATC	7 cut(s)	91, 102, 111, 115, 168, 200, 321
Eam1104I	CTCTTC	1 cut(s)	201
EarI	CTCTTC	1 cut(s)	201
EciI	GGCGGA	1 cut(s)	173
Eco31I	GGTCTC	1 cut(s)	353
Eco88I	CYCGRG	1 cut(s)	223
EcoRII	CCWGG	2 cut(s)	107, 378
FaeI	CATG	1 cut(s)	328
FaiI	YATR	3 cut(s)	150, 326, 335
FaqI	GGGAC	2 cut(s)	240, 265
FatI	CATG	1 cut(s)	324
Fnu4HI	GCNGC	1 cut(s)	290
Fsp4HI	GCNGC	1 cut(s)	290
GluI	GCNGC	1 cut(s)	290
HaeIII	GGCC	1 cut(s)	5
HapII	CCGG	2 cut(s)	205, 224
HgaI	GACGC	2 cut(s)	132, 197
Hin1I	GRCGYC	2 cut(s)	124, 208
Hin1II	CATG	1 cut(s)	328
HinfI	GANTC	3 cut(s)	69, 180, 228
HpaII	CCGG	2 cut(s)	205, 224
Hpy188I	TCNGA	3 cut(s)	76, 307, 431
Hpy188III	TCNNGA	2 cut(s)	325, 367
Hpy99I	CGWCG	3 cut(s)	126, 213, 289
HpyAV	CCTTC	1 cut(s)	27
HpyCH4III	ACNGT	1 cut(s)	256
HpyCH4V	TGCA	3 cut(s)	145, 259, 400
HpyF3I	CTNAG	1 cut(s)	272
Hsp92I	GRCGYC	2 cut(s)	124, 208
Hsp92II	CATG	1 cut(s)	328
Kzo9I	GATC	7 cut(s)	91, 102, 111, 115, 168, 200, 321
LpnPI	CCDG	8 cut(s)	94, 102, 121, 188, 218, 237, 365, 392
LweI	GCATC	1 cut(s)	74
MabI	ACCWGGT	1 cut(s)	378
MaeIII	GTNAC	1 cut(s)	297
MalI	GATC	7 cut(s)	93, 104, 113, 117, 170, 202, 323
MboI	GATC	7 cut(s)	91, 102, 111, 115, 168, 200, 321
MboII	GAAGA	2 cut(s)	110, 188
MluCI	AATT	1 cut(s)	385
MlyI	GAGTC	2 cut(s)	78, 222
MnlI	CCTC	9 cut(s)	16, 33, 72, 145, 242, 245, 291, 304, 374
MseI	TTAA	1 cut(s)	384
MspI	CCGG	2 cut(s)	205, 224
MspR9I	CCNGG	5 cut(s)	109, 205, 224, 225, 380
MvaI	CCWGG	2 cut(s)	109, 380
NciI	CCSGG	3 cut(s)	205, 224, 225
NdeII	GATC	7 cut(s)	91, 102, 111, 115, 168, 200, 321
NlaIII	CATG	1 cut(s)	328
PagI	TCATGA	1 cut(s)	324
PcsI	WCGNNNNNNNCGW	3 cut(s)	64, 205, 293
PfeI	GAWTC	1 cut(s)	180
PfoI	TCCNGGA	1 cut(s)	107
PkrI	GCNGC	1 cut(s)	291
PleI	GAGTC	2 cut(s)	77, 222
PpsI	GAGTC	2 cut(s)	77, 222
Psp6I	CCWGG	2 cut(s)	107, 378
PspGI	CCWGG	2 cut(s)	107, 378
SaqAI	TTAA	1 cut(s)	384
SatI	GCNGC	1 cut(s)	290
Sau3AI	GATC	7 cut(s)	91, 102, 111, 115, 168, 200, 321
SchI	GAGTC	2 cut(s)	78, 222
ScrFI	CCNGG	5 cut(s)	109, 205, 224, 225, 380
SetI	ASST	5 cut(s)	194, 266, 349, 366, 384
SexAI	ACCWGGT	1 cut(s)	378
SfaNI	GCATC	1 cut(s)	74
SmaI	CCCGGG	1 cut(s)	225
SmlI	CTYRAG	1 cut(s)	365
SmoI	CTYRAG	1 cut(s)	365
Sse9I	AATT	1 cut(s)	385
SsiI	CCGC	3 cut(s)	184, 218, 290
StyD4I	CCNGG	5 cut(s)	107, 203, 222, 223, 378
TaaI	ACNGT	1 cut(s)	256
TaqI	TCGA	4 cut(s)	94, 114, 121, 199
TasI	AATT	1 cut(s)	385
TauI	GCSGC	1 cut(s)	292
TfiI	GAWTC	1 cut(s)	180
Tru1I	TTAA	1 cut(s)	384
Tru9I	TTAA	1 cut(s)	384
TspDTI	ATGAA	1 cut(s)	165
TspGWI	ACGGA	1 cut(s)	273
TspMI	CCCGGG	1 cut(s)	223
XmaI	CCCGGG	1 cut(s)	223

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.