MD05G1073900.v1.1

AP2-like ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
N/A
Physical Location & Seq
Forward (+)
15568416 .. 15570108
1693 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1073900.v1.1.491

Sequence Viewer

Length: 183 bp
ATGCGGTCTTTACAAGAAAAGCAGTTGATTCTGAAGAGGGGCTTCAATGTACAGAAGAATTACAAGTGTAGCAGACGTCATCAACATGGAAGATGGCTAGCCAGGATTGGAAAGGTTGCTAGAAATAAGGATCTCTATCTTGGGCATTCAAGAAATGCACAAAAAATTGATGACATCCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.19

Weight (kDa)

11.03

Isoelectric Point (pI)

70.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 79
AciI CCGC 1 cut(s) 4
AclWI GGATC 1 cut(s) 138
AcuI CTGAAG 1 cut(s) 53
AcyI GRCGYC 1 cut(s) 76
AfaI GTAC 1 cut(s) 51
AgsI TTSAA 2 cut(s) 46, 150
AjnI CCWGG 1 cut(s) 101
AlwI GGATC 1 cut(s) 138
AsuNHI GCTAGC 1 cut(s) 97
BccI CCATC 1 cut(s) 87
BciT130I CCWGG 1 cut(s) 103
BfaI CTAG 2 cut(s) 98, 120
Bme1390I CCNGG 1 cut(s) 103
BmrFI CCNGG 1 cut(s) 103
BmtI GCTAGC 1 cut(s) 101
BsaBI GATNNNNATC 1 cut(s) 135
BsaHI GRCGYC 1 cut(s) 76
Bse8I GATNNNNATC 1 cut(s) 135
BseBI CCWGG 1 cut(s) 103
BseGI GGATG 1 cut(s) 174
BseJI GATNNNNATC 1 cut(s) 135
BsmI GAATGC 1 cut(s) 145
Bsp1407I TGTACA 1 cut(s) 49
Bsp143I GATC 1 cut(s) 130
BspACI CCGC 1 cut(s) 4
BspOI GCTAGC 1 cut(s) 101
BspPI GGATC 1 cut(s) 138
BsrGI TGTACA 1 cut(s) 49
BssMI GATC 1 cut(s) 130
BssNI GRCGYC 1 cut(s) 76
Bst2UI CCWGG 1 cut(s) 103
Bst6I CTCTTC 1 cut(s) 29
BstACI GRCGYC 1 cut(s) 76
BstAUI TGTACA 1 cut(s) 49
BstC8I GCNNGC 1 cut(s) 99
BstF5I GGATG 1 cut(s) 174
BstKTI GATC 1 cut(s) 133
BstMBI GATC 1 cut(s) 130
BstNI CCWGG 1 cut(s) 103
BstSCI CCNGG 1 cut(s) 101
BstX2I RGATCY 1 cut(s) 130
BstYI RGATCY 1 cut(s) 130
BtsCI GGATG 1 cut(s) 174
Cac8I GCNNGC 1 cut(s) 99
Csp6I GTAC 1 cut(s) 50
CviAII CATG 1 cut(s) 86
CviJI RGCY 3 cut(s) 42, 97, 101
CviKI_1 RGCY 3 cut(s) 42, 97, 101
CviQI GTAC 1 cut(s) 50
DpnI GATC 1 cut(s) 132
DpnII GATC 1 cut(s) 130
Eam1104I CTCTTC 1 cut(s) 29
EarI CTCTTC 1 cut(s) 29
Eco57I CTGAAG 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 101
FaeI CATG 1 cut(s) 89
FaiI YATR 2 cut(s) 87, 181
FalI AAGNNNNNCTT 2 cut(s) 26, 58
FatI CATG 1 cut(s) 85
FokI GGATG 1 cut(s) 161
FspBI CTAG 2 cut(s) 98, 120
Hin1I GRCGYC 1 cut(s) 76
Hin1II CATG 1 cut(s) 89
HinfI GANTC 1 cut(s) 28
Hpy188I TCNGA 1 cut(s) 33
Hpy188III TCNNGA 1 cut(s) 150
HpyCH4IV ACGT 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 158
HpySE526I ACGT 1 cut(s) 76
Hsp92I GRCGYC 1 cut(s) 76
Hsp92II CATG 1 cut(s) 89
Kzo9I GATC 1 cut(s) 130
LpnPI CCDG 2 cut(s) 88, 115
MaeI CTAG 2 cut(s) 98, 120
MaeII ACGT 1 cut(s) 76
MalI GATC 1 cut(s) 132
MboI GATC 1 cut(s) 130
MboII GAAGA 3 cut(s) 46, 67, 102
MflI RGATCY 1 cut(s) 130
MluCI AATT 2 cut(s) 58, 165
MnlI CCTC 1 cut(s) 30
MslI CAYNNNNRTG 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 103
Mva1269I GAATGC 1 cut(s) 145
MvaI CCWGG 1 cut(s) 103
NdeII GATC 1 cut(s) 130
NheI GCTAGC 1 cut(s) 97
NlaIII CATG 1 cut(s) 89
PctI GAATGC 1 cut(s) 145
PfeI GAWTC 1 cut(s) 28
Psp6I CCWGG 1 cut(s) 101
PspGI CCWGG 1 cut(s) 101
PsuI RGATCY 1 cut(s) 130
RsaI GTAC 1 cut(s) 51
RsaNI GTAC 1 cut(s) 50
RseI CAYNNNNRTG 1 cut(s) 84
Sau3AI GATC 1 cut(s) 130
ScrFI CCNGG 1 cut(s) 103
SetI ASST 2 cut(s) 79, 117
SgeI CNNG 9 cut(s) 26, 76, 98, 110, 114, 115, 132, 152, 162
SmiMI CAYNNNNRTG 1 cut(s) 84
Sse9I AATT 2 cut(s) 58, 165
SsiI CCGC 1 cut(s) 4
SspMI CTAG 2 cut(s) 98, 120
StyD4I CCNGG 1 cut(s) 101
TaiI ACGT 1 cut(s) 79
TasI AATT 2 cut(s) 58, 165
TatI WGTACW 1 cut(s) 49
TfiI GAWTC 1 cut(s) 28
XspI CTAG 2 cut(s) 98, 120
ZraI GACGTC 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.