MD08G1166300.v1.1

prolyl-tRNA synthetase associated domain-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
N/A
Physical Location & Seq
Forward (+)
19729013 .. 19730436
1424 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1166300.v1.1.491

Sequence Viewer

Length: 354 bp
ATGATTTGTTTTCATCGGGCCAAATATGTTGGAAATCTGGGAGGTGGACTGAGTGAAAATTTATTCTTGACGGACAAGAAAAGAAGGTTTTATAATTTTTCCGCTTCGGCAGATGCTAAATTAGATTTGAAAGCGGTTCTATCTGTGGGGCTTGGTTTGGGAAGAGGGGGCTTGAGAATGGCTCCTGAAGAAGCACTTGGAGAAATACTTCAGGTCCCTCTGGGTTGCGTTATGCCTTTTTCCCTGGTGAATGAATCTGGACGCCATGTCTCTCTGTTGTTGGATCACAAATTTAAAAGTCAGGAGTGGTGCTTCTTCCACCCTTTATCGAATGACATGTCAATCTGTAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

12.95

Weight (kDa)

8.76

Isoelectric Point (pI)

47.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA_edit PF04073 9 - 114 4.8e-14 Aminoacyl-tRNA editing domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 93
AciI CCGC 2 cut(s) 102, 134
AclWI GGATC 1 cut(s) 291
AcsI RAATTY 2 cut(s) 58, 290
AcuI CTGAAG 2 cut(s) 194, 207
AcyI GRCGYC 1 cut(s) 262
AflIII ACRYGT 1 cut(s) 336
AgsI TTSAA 1 cut(s) 130
AhdI GACNNNNNGTC 1 cut(s) 266
AjnI CCWGG 1 cut(s) 243
AjuI GAANNNNNNNTTGG 2 cut(s) 180, 212
Alw26I GTCTC 1 cut(s) 274
AlwI GGATC 1 cut(s) 291
AoxI GGCC 1 cut(s) 18
ApoI RAATTY 2 cut(s) 58, 290
ArsI GACNNNNNNTTYG 1 cut(s) 323
Asp700I GAANNNNTTC 1 cut(s) 207
AspS9I GGNCC 2 cut(s) 18, 214
AsuHPI GGTGA 1 cut(s) 259
AvaII GGWCC 1 cut(s) 214
BciT130I CCWGG 1 cut(s) 245
BcoDI GTCTC 1 cut(s) 274
Bme1390I CCNGG 1 cut(s) 245
Bme18I GGWCC 1 cut(s) 214
BmeRI GACNNNNNGTC 1 cut(s) 266
BmgT120I GGNCC 2 cut(s) 18, 214
BmiI GGNNCC 2 cut(s) 183, 216
BmrFI CCNGG 1 cut(s) 245
BmsI GCATC 1 cut(s) 103
BplI GAGNNNNNCTC 2 cut(s) 166, 198
BpuEI CTTGAG 1 cut(s) 193
BsaHI GRCGYC 1 cut(s) 262
BsaJI CCNNGG 1 cut(s) 243
BseBI CCWGG 1 cut(s) 245
BseDI CCNNGG 1 cut(s) 243
BseMII CTCAG 1 cut(s) 41
BshFI GGCC 1 cut(s) 20
BslFI GGGAC 1 cut(s) 200
BsmAI GTCTC 1 cut(s) 274
BsmFI GGGAC 1 cut(s) 200
BsnI GGCC 1 cut(s) 20
Bsp143I GATC 1 cut(s) 283
BspACI CCGC 2 cut(s) 102, 134
BspANI GGCC 1 cut(s) 20
BspCNI CTCAG 1 cut(s) 42
BspLI GGNNCC 2 cut(s) 183, 216
BspPI GGATC 1 cut(s) 291
BssECI CCNNGG 1 cut(s) 243
BssMI GATC 1 cut(s) 283
BssNI GRCGYC 1 cut(s) 262
Bst2UI CCWGG 1 cut(s) 245
Bst6I CTCTTC 1 cut(s) 157
BstACI GRCGYC 1 cut(s) 262
BstDEI CTNAG 1 cut(s) 50
BstKTI GATC 1 cut(s) 286
BstMAI GTCTC 1 cut(s) 274
BstMBI GATC 1 cut(s) 283
BstNI CCWGG 1 cut(s) 245
BstNSI RCATGY 1 cut(s) 340
BstSCI CCNGG 1 cut(s) 243
BsuRI GGCC 1 cut(s) 20
Cfr13I GGNCC 2 cut(s) 18, 214
CseI GACGC 1 cut(s) 270
CviAII CATG 2 cut(s) 266, 337
CviJI RGCY 4 cut(s) 20, 151, 171, 182
CviKI_1 RGCY 4 cut(s) 20, 151, 171, 182
DdeI CTNAG 1 cut(s) 50
DpnI GATC 1 cut(s) 285
DpnII GATC 1 cut(s) 283
DraI TTTAAA 1 cut(s) 295
DriI GACNNNNNGTC 1 cut(s) 266
Eam1104I CTCTTC 1 cut(s) 157
Eam1105I GACNNNNNGTC 1 cut(s) 266
EarI CTCTTC 1 cut(s) 157
Eco47I GGWCC 1 cut(s) 214
Eco57I CTGAAG 2 cut(s) 194, 207
EcoO109I RGGNCCY 1 cut(s) 214
EcoRII CCWGG 1 cut(s) 243
FaeI CATG 2 cut(s) 269, 340
FaiI YATR 5 cut(s) 27, 93, 233, 267, 338
FalI AAGNNNNNCTT 2 cut(s) 180, 212
FaqI GGGAC 1 cut(s) 200
FatI CATG 2 cut(s) 265, 336
HaeIII GGCC 1 cut(s) 20
HgaI GACGC 1 cut(s) 270
Hin1I GRCGYC 1 cut(s) 262
Hin1II CATG 2 cut(s) 269, 340
HinfI GANTC 1 cut(s) 254
HphI GGTGA 1 cut(s) 259
Hpy166II GTNNAC 1 cut(s) 47
Hpy188III TCNNGA 4 cut(s) 67, 185, 258, 302
Hpy8I GTNNAC 1 cut(s) 47
HpyAV CCTTC 1 cut(s) 78
HpyF3I CTNAG 1 cut(s) 50
Hsp92I GRCGYC 1 cut(s) 262
Hsp92II CATG 2 cut(s) 269, 340
Kzo9I GATC 1 cut(s) 283
LmnI GCTCC 1 cut(s) 187
LpnPI CCDG 8 cut(s) 23, 197, 198, 206, 230, 243, 257, 287
LweI GCATC 1 cut(s) 103
MalI GATC 1 cut(s) 285
MboI GATC 1 cut(s) 283
MboII GAAGA 3 cut(s) 174, 200, 307
MluCI AATT 4 cut(s) 58, 94, 119, 290
MmeI TCCRAC 2 cut(s) 10, 261
MnlI CCTC 3 cut(s) 35, 158, 228
MroXI GAANNNNTTC 1 cut(s) 207
MseI TTAA 1 cut(s) 294
MspR9I CCNGG 1 cut(s) 245
MvaI CCWGG 1 cut(s) 245
NdeII GATC 1 cut(s) 283
NlaIII CATG 2 cut(s) 269, 340
NlaIV GGNNCC 2 cut(s) 183, 216
NspI RCATGY 1 cut(s) 340
PciI ACATGT 1 cut(s) 336
PdmI GAANNNNTTC 1 cut(s) 207
PfeI GAWTC 1 cut(s) 254
PpuMI RGGWCCY 1 cut(s) 214
PscI ACATGT 1 cut(s) 336
PsiI TTATAA 1 cut(s) 93
Psp5II RGGWCCY 1 cut(s) 214
Psp6I CCWGG 1 cut(s) 243
PspGI CCWGG 1 cut(s) 243
PspN4I GGNNCC 2 cut(s) 183, 216
PspPI GGNCC 2 cut(s) 18, 214
PspPPI RGGWCCY 1 cut(s) 214
SaqAI TTAA 1 cut(s) 294
Sau3AI GATC 1 cut(s) 283
Sau96I GGNCC 2 cut(s) 18, 214
ScrFI CCNGG 1 cut(s) 245
SetI ASST 3 cut(s) 46, 89, 216
SfaNI GCATC 1 cut(s) 103
SinI GGWCC 1 cut(s) 214
SmlI CTYRAG 1 cut(s) 172
SmoI CTYRAG 1 cut(s) 172
Sse9I AATT 4 cut(s) 58, 94, 119, 290
SsiI CCGC 2 cut(s) 102, 134
StyD4I CCNGG 1 cut(s) 243
TaqI TCGA 1 cut(s) 329
TasI AATT 4 cut(s) 58, 94, 119, 290
TfiI GAWTC 1 cut(s) 254
Tru1I TTAA 1 cut(s) 294
Tru9I TTAA 1 cut(s) 294
TspDTI ATGAA 1 cut(s) 267
TspGWI ACGGA 1 cut(s) 86
VpaK11BI GGWCC 1 cut(s) 214
XapI RAATTY 2 cut(s) 58, 290
XceI RCATGY 1 cut(s) 340
XmnI GAANNNNTTC 1 cut(s) 207
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.