MD10G1186900.v1.1
BHLH Family

Pentatricopeptide repeat-containing protein At1g06145-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
N/A
Physical Location & Seq
Reverse (-)
28098404 .. 28098652
249 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1186900.v1.1.491

Sequence Viewer

Length: 249 bp
ATGTTACCGTCCATAGTTGAAAATTTGAAGGAATGTTCGACTCCAACAGAGCTAGAAAGTGTATGTGCCTCAATGATCAGGACCAATGCCATCCAAGACTCTTTCTTTACGAACCAACTCATCCCCGCCTTTTCAACATTGTCCCGCCTAGATTATGCAGTTTTAGCCTTCAGCCACATGGAAAATCTGAACGTTTTTGTCTTCAATGCGATGATCAGAGGCTTTGTTCATTCCGACCACCCATTTTAG

Protein Analysis

83

Amino Acids

9.26

Weight (kDa)

5.04

Isoelectric Point (pI)

30.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 126, 145
AclI AACGTT 1 cut(s) 192
AcsI RAATTY 1 cut(s) 22
AcuI CTGAAG 1 cut(s) 154
AgsI TTSAA 4 cut(s) 20, 28, 135, 205
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
ApoI RAATTY 1 cut(s) 22
AspS9I GGNCC 1 cut(s) 81
AvaII GGWCC 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 193
BccI CCATC 1 cut(s) 98
BclI TGATCA 2 cut(s) 75, 213
BfaI CTAG 2 cut(s) 53, 149
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 81
BpiI GAAGAC 1 cut(s) 193
BseGI GGATG 2 cut(s) 90, 120
BslFI GGGAC 1 cut(s) 127
BsmFI GGGAC 1 cut(s) 127
Bsp143I GATC 2 cut(s) 75, 213
BspACI CCGC 2 cut(s) 126, 145
BssMI GATC 2 cut(s) 75, 213
Bst4CI ACNGT 1 cut(s) 9
BstF5I GGATG 2 cut(s) 90, 120
BstKTI GATC 2 cut(s) 78, 216
BstMBI GATC 2 cut(s) 75, 213
BstMWI GCNNNNNNNGC 1 cut(s) 164
BstV2I GAAGAC 1 cut(s) 193
BtgZI GCGATG 1 cut(s) 224
BtsCI GGATG 2 cut(s) 90, 120
Cfr13I GGNCC 1 cut(s) 81
CviAII CATG 1 cut(s) 178
CviJI RGCY 4 cut(s) 52, 167, 174, 222
CviKI_1 RGCY 4 cut(s) 52, 167, 174, 222
DpnI GATC 2 cut(s) 77, 215
DpnII GATC 2 cut(s) 75, 213
Eco47I GGWCC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 154
FaeI CATG 1 cut(s) 181
FaiI YATR 4 cut(s) 14, 64, 156, 179
FaqI GGGAC 1 cut(s) 127
FatI CATG 1 cut(s) 177
FauI CCCGC 2 cut(s) 133, 152
FbaI TGATCA 2 cut(s) 75, 213
FokI GGATG 2 cut(s) 77, 107
FspBI CTAG 2 cut(s) 53, 149
Hin1II CATG 1 cut(s) 181
HinfI GANTC 2 cut(s) 40, 98
Hpy188I TCNGA 3 cut(s) 189, 218, 235
Hpy188III TCNNGA 1 cut(s) 79
HpyAV CCTTC 2 cut(s) 22, 178
HpyCH4III ACNGT 1 cut(s) 9
HpyCH4IV ACGT 1 cut(s) 192
HpyCH4V TGCA 1 cut(s) 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 164
HpySE526I ACGT 1 cut(s) 192
Hsp92II CATG 1 cut(s) 181
Ksp22I TGATCA 2 cut(s) 75, 213
Kzo9I GATC 2 cut(s) 75, 213
LpnPI CCDG 1 cut(s) 64
MaeI CTAG 2 cut(s) 53, 149
MaeII ACGT 1 cut(s) 192
MaeIII GTNAC 1 cut(s) 3
MalI GATC 2 cut(s) 77, 215
MboI GATC 2 cut(s) 75, 213
MboII GAAGA 1 cut(s) 193
MluCI AATT 1 cut(s) 22
MlyI GAGTC 2 cut(s) 34, 92
MmeI TCCRAC 1 cut(s) 68
MnlI CCTC 2 cut(s) 79, 212
MwoI GCNNNNNNNGC 1 cut(s) 164
NdeII GATC 2 cut(s) 75, 213
NlaIII CATG 1 cut(s) 181
PleI GAGTC 2 cut(s) 34, 92
PpsI GAGTC 2 cut(s) 34, 92
Psp1406I AACGTT 1 cut(s) 192
PspPI GGNCC 1 cut(s) 81
Sau3AI GATC 2 cut(s) 75, 213
Sau96I GGNCC 1 cut(s) 81
SchI GAGTC 2 cut(s) 34, 92
SetI ASST 2 cut(s) 54, 195
SgeI CNNG 7 cut(s) 65, 91, 107, 137, 156, 161, 190
SinI GGWCC 1 cut(s) 81
Sse9I AATT 1 cut(s) 22
SsiI CCGC 2 cut(s) 126, 145
SspMI CTAG 2 cut(s) 53, 149
TaaI ACNGT 1 cut(s) 9
TaiI ACGT 1 cut(s) 195
TaqI TCGA 1 cut(s) 38
TasI AATT 1 cut(s) 22
TspDTI ATGAA 1 cut(s) 218
VpaK11BI GGWCC 1 cut(s) 81
XapI RAATTY 1 cut(s) 22
XspI CTAG 2 cut(s) 53, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.