Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr14

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

6833703 .. 6834104

Gene Structure 402 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD14G1064900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 273 bp

ATGATCAACTTCTCCTTGGTACAAATTGTTTGCTTTCTCAACAGTCAACTTTCGCTAGTTACCTGGTTTATTGTTCTTTTTGGCATCTTTCTTTTTGGAGCAAGTCCTAGCTTTGCCAAGGGTTTATCTAATTATCGTGGAGTTTCAAGGATCTCAGGCAAAAAGAAATGGCAAGCTAGACTAGGGAGAGGTAAACGGCACAATGGCCTTTATCTGGGTACATTTGGTAAGTCATATGACCCATATGCCTCATTTTATCCATTAATGGCTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000723 GO:0003674 GO:0003700 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006139 GO:0006259 GO:0006355 GO:0006725 GO:0006807 GO:0006996 GO:0007275 GO:0007389 GO:0008150 GO:0008152 GO:0009888 GO:0009889 GO:0009987 GO:0010073 GO:0010449 GO:0010468 GO:0010556 GO:0016043 GO:0019219 GO:0019222 GO:0019827 GO:0022622 GO:0031323 GO:0031326 GO:0032200 GO:0032501 GO:0032502 GO:0034641 GO:0035266 GO:0040007 GO:0042592 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044237 GO:0044238 GO:0044260 GO:0044424 GO:0044464 GO:0046483 GO:0048364 GO:0048507 GO:0048589 GO:0048731 GO:0048856 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0051276 GO:0060249 GO:0060255 GO:0065007 GO:0065008 GO:0071704 GO:0071840 GO:0080090 GO:0090304 GO:0098727 GO:0099402 GO:0140110 GO:1901360 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AP2

Protein Analysis

91

Amino Acids

10.14

Weight (kDa)

10.41

Isoelectric Point (pI)

24.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	158
AfaI	GTAC	2 cut(s)	21, 220
AfiI	CCNNNNNNNGG	1 cut(s)	214
AgsI	TTSAA	1 cut(s)	147
AjnI	CCWGG	1 cut(s)	62
AluBI	AGCT	2 cut(s)	111, 176
AluI	AGCT	2 cut(s)	111, 176
AlwI	GGATC	1 cut(s)	158
AoxI	GGCC	1 cut(s)	205
AseI	ATTAAT	1 cut(s)	263
BceAI	ACGGC	1 cut(s)	212
BciT130I	CCWGG	1 cut(s)	64
BclI	TGATCA	1 cut(s)	3
BfaI	CTAG	4 cut(s)	56, 108, 177, 182
Bme1390I	CCNGG	1 cut(s)	64
BmrFI	CCNGG	1 cut(s)	64
BmsI	GCATC	1 cut(s)	93
BsaJI	CCNNGG	2 cut(s)	15, 117
Bsc4I	CCNNNNNNNGG	1 cut(s)	214
BseBI	CCWGG	1 cut(s)	64
BseDI	CCNNGG	2 cut(s)	15, 117
BseLI	CCNNNNNNNGG	1 cut(s)	214
BseMII	CTCAG	1 cut(s)	168
BshFI	GGCC	1 cut(s)	207
BslI	CCNNNNNNNGG	1 cut(s)	214
BsnI	GGCC	1 cut(s)	207
Bsp143I	GATC	2 cut(s)	3, 150
BspANI	GGCC	1 cut(s)	207
BspCNI	CTCAG	1 cut(s)	167
BspPI	GGATC	1 cut(s)	158
BssECI	CCNNGG	2 cut(s)	15, 117
BssMI	GATC	2 cut(s)	3, 150
BssT1I	CCWWGG	2 cut(s)	15, 117
Bst2UI	CCWGG	1 cut(s)	64
Bst4CI	ACNGT	1 cut(s)	44
BstC8I	GCNNGC	1 cut(s)	174
BstDEI	CTNAG	1 cut(s)	154
BstKTI	GATC	2 cut(s)	6, 153
BstMBI	GATC	2 cut(s)	3, 150
BstNI	CCWGG	1 cut(s)	64
BstSCI	CCNGG	1 cut(s)	62
BstX2I	RGATCY	1 cut(s)	150
BstYI	RGATCY	1 cut(s)	150
BsuRI	GGCC	1 cut(s)	207
Cac8I	GCNNGC	1 cut(s)	174
CsiI	ACCWGGT	1 cut(s)	62
Csp6I	GTAC	2 cut(s)	20, 219
CviJI	RGCY	4 cut(s)	111, 176, 207, 269
CviKI_1	RGCY	4 cut(s)	111, 176, 207, 269
CviQI	GTAC	2 cut(s)	20, 219
DdeI	CTNAG	1 cut(s)	154
DpnI	GATC	2 cut(s)	5, 152
DpnII	GATC	2 cut(s)	3, 150
Eco130I	CCWWGG	2 cut(s)	15, 117
EcoRII	CCWGG	1 cut(s)	62
EcoT14I	CCWWGG	2 cut(s)	15, 117
ErhI	CCWWGG	2 cut(s)	15, 117
FaiI	YATR	4 cut(s)	235, 237, 244, 246
FauNDI	CATATG	2 cut(s)	235, 244
FbaI	TGATCA	1 cut(s)	3
FspBI	CTAG	4 cut(s)	56, 108, 177, 182
HaeIII	GGCC	1 cut(s)	207
HincII	GTYRAC	1 cut(s)	47
HindII	GTYRAC	1 cut(s)	47
Hpy166II	GTNNAC	2 cut(s)	47, 194
Hpy8I	GTNNAC	2 cut(s)	47, 194
HpyCH4III	ACNGT	1 cut(s)	44
HpyF3I	CTNAG	1 cut(s)	154
Ksp22I	TGATCA	1 cut(s)	3
Kzo9I	GATC	2 cut(s)	3, 150
LmnI	GCTCC	1 cut(s)	98
LpnPI	CCDG	4 cut(s)	49, 76, 141, 200
LweI	GCATC	1 cut(s)	93
MabI	ACCWGGT	1 cut(s)	62
MaeI	CTAG	4 cut(s)	56, 108, 177, 182
MaeIII	GTNAC	1 cut(s)	58
MalI	GATC	2 cut(s)	5, 152
MboI	GATC	2 cut(s)	3, 150
MflI	RGATCY	1 cut(s)	150
MluCI	AATT	2 cut(s)	24, 130
MnlI	CCTC	2 cut(s)	182, 259
MseI	TTAA	1 cut(s)	263
MspR9I	CCNGG	1 cut(s)	64
MvaI	CCWGG	1 cut(s)	64
NdeI	CATATG	2 cut(s)	235, 244
NdeII	GATC	2 cut(s)	3, 150
PshBI	ATTAAT	1 cut(s)	263
Psp6I	CCWGG	1 cut(s)	62
PspGI	CCWGG	1 cut(s)	62
PsuI	RGATCY	1 cut(s)	150
RsaI	GTAC	2 cut(s)	21, 220
RsaNI	GTAC	2 cut(s)	20, 219
SaqAI	TTAA	1 cut(s)	263
Sau3AI	GATC	2 cut(s)	3, 150
ScrFI	CCNGG	1 cut(s)	64
SetI	ASST	4 cut(s)	65, 113, 178, 193
SexAI	ACCWGGT	1 cut(s)	62
SfaNI	GCATC	1 cut(s)	93
Sse9I	AATT	2 cut(s)	24, 130
SspMI	CTAG	4 cut(s)	56, 108, 177, 182
StyD4I	CCNGG	1 cut(s)	62
StyI	CCWWGG	2 cut(s)	15, 117
TaaI	ACNGT	1 cut(s)	44
TasI	AATT	2 cut(s)	24, 130
Tru1I	TTAA	1 cut(s)	263
Tru9I	TTAA	1 cut(s)	263
VspI	ATTAAT	1 cut(s)	263
XspI	CTAG	4 cut(s)	56, 108, 177, 182

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.