Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr15

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

3480335 .. 3480987

Gene Structure 653 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD15G1051100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 192 bp

ATGTTCCTAAACAAGCAGATGGTCTCCAATAGCGGGAGAATTCCAGGACGAACAAACAATGACATCAAGAATTACTGGAATAACAATTTATGTAAGACACCACAACAGGAAGATAAATTATCATGTAGACCCTCCACCTCCACTGAGTTTTCAGACACAATATACAACAATCAAAAGTTGAAGAAAAACTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000981 GO:0000988 GO:0000989 GO:0001067 GO:0001076 GO:0001134 GO:0001135 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006082 GO:0006355 GO:0006357 GO:0006629 GO:0006631 GO:0006633 GO:0006725 GO:0006950 GO:0006970 GO:0008150 GO:0008152 GO:0008610 GO:0009058 GO:0009628 GO:0009698 GO:0009699 GO:0009889 GO:0009987 GO:0010023 GO:0010468 GO:0010556 GO:0016053 GO:0017144 GO:0018130 GO:0018958 GO:0019219 GO:0019222 GO:0019438 GO:0019748 GO:0019752 GO:0030154 GO:0031323 GO:0031326 GO:0032502 GO:0032787 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043436 GO:0043565 GO:0044212 GO:0044237 GO:0044238 GO:0044249 GO:0044255 GO:0044281 GO:0044283 GO:0044424 GO:0044464 GO:0044550 GO:0046189 GO:0046394 GO:0046483 GO:0048869 GO:0050789 GO:0050794 GO:0050896 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0071704 GO:0072330 GO:0080090 GO:0097159 GO:0140110 GO:1901360 GO:1901362 GO:1901363 GO:1901576 GO:1901615 GO:1901617 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

64

Amino Acids

7.36

Weight (kDa)

9.57

Isoelectric Point (pI)

31.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	127
AciI	CCGC	1 cut(s)	33
AcsI	RAATTY	1 cut(s)	39
AfiI	CCNNNNNNNGG	1 cut(s)	33
AgsI	TTSAA	1 cut(s)	181
AjnI	CCWGG	1 cut(s)	43
Alw26I	GTCTC	1 cut(s)	28
ApoI	RAATTY	1 cut(s)	39
BccI	CCATC	1 cut(s)	13
BciT130I	CCWGG	1 cut(s)	45
BcoDI	GTCTC	1 cut(s)	28
Bme1390I	CCNGG	1 cut(s)	45
BmrFI	CCNGG	1 cut(s)	45
BsaI	GGTCTC	1 cut(s)	28
Bsc4I	CCNNNNNNNGG	1 cut(s)	33
Bse1I	ACTGG	1 cut(s)	80
BseBI	CCWGG	1 cut(s)	45
BseLI	CCNNNNNNNGG	1 cut(s)	33
BseMII	CTCAG	1 cut(s)	135
BseNI	ACTGG	1 cut(s)	80
BslI	CCNNNNNNNGG	1 cut(s)	33
BsmAI	GTCTC	1 cut(s)	28
Bso31I	GGTCTC	1 cut(s)	28
BspACI	CCGC	1 cut(s)	33
BspCNI	CTCAG	1 cut(s)	136
BspTNI	GGTCTC	1 cut(s)	28
BsrI	ACTGG	1 cut(s)	80
Bst2UI	CCWGG	1 cut(s)	45
BstDEI	CTNAG	1 cut(s)	144
BstMAI	GTCTC	1 cut(s)	28
BstNI	CCWGG	1 cut(s)	45
BstSCI	CCNGG	1 cut(s)	43
BtsIMutI	CAGTG	1 cut(s)	141
CviAII	CATG	1 cut(s)	123
DdeI	CTNAG	1 cut(s)	144
Eco31I	GGTCTC	1 cut(s)	28
EcoRI	GAATTC	1 cut(s)	39
EcoRII	CCWGG	1 cut(s)	43
FaeI	CATG	1 cut(s)	126
FaiI	YATR	3 cut(s)	91, 124, 163
FatI	CATG	1 cut(s)	122
FauI	CCCGC	1 cut(s)	26
FblI	GTMKAC	1 cut(s)	127
Hin1II	CATG	1 cut(s)	126
Hpy166II	GTNNAC	1 cut(s)	128
Hpy188I	TCNGA	1 cut(s)	154
Hpy188III	TCNNGA	1 cut(s)	67
Hpy8I	GTNNAC	1 cut(s)	128
HpyF3I	CTNAG	1 cut(s)	144
Hsp92II	CATG	1 cut(s)	126
LpnPI	CCDG	4 cut(s)	30, 57, 61, 92
MboII	GAAGA	1 cut(s)	122
MluCI	AATT	4 cut(s)	39, 70, 85, 116
MnlI	CCTC	2 cut(s)	142, 148
MspR9I	CCNGG	1 cut(s)	45
MvaI	CCWGG	1 cut(s)	45
NlaIII	CATG	1 cut(s)	126
PfoI	TCCNGGA	1 cut(s)	43
Psp6I	CCWGG	1 cut(s)	43
PspGI	CCWGG	1 cut(s)	43
ScrFI	CCNGG	1 cut(s)	45
SetI	ASST	1 cut(s)	140
SgeI	CNNG	8 cut(s)	25, 46, 56, 57, 79, 88, 119, 135
Sse9I	AATT	4 cut(s)	39, 70, 85, 116
SsiI	CCGC	1 cut(s)	33
StyD4I	CCNGG	1 cut(s)	43
TasI	AATT	4 cut(s)	39, 70, 85, 116
TscAI	CASTG	1 cut(s)	148
TspRI	CASTG	1 cut(s)	148
XapI	RAATTY	1 cut(s)	39
XmiI	GTMKAC	1 cut(s)	127

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.