Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr15

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

52823958 .. 52825083

Gene Structure 1126 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD15G1427700.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 291 bp

ATGTGCATTGGATGGCCGTGTTTCATATTCAGATTGGACCAGTATACTGTAGCAAAATTTGCCAAAGGCTTTGACACGATGCCTAAATTTCTTGAGAAAAATGCTGGGCTTAATGCAACGGAGATCATATCTTCTATATGTGCTGAACATGCATCAGGAAATACCAAAGTTTGCCTTGACCAAGTAAGCTGTTCCTTGTCTTGTAACAGTTCATGCTTTTGTATGAGAGTTTCCATTGCATTGATTTGTCTGTATGTTGTCACGCTGTGGTGTGTGCTTGCTGGTAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005832 GO:0005911 GO:0006457 GO:0006458 GO:0008150 GO:0009506 GO:0009987 GO:0016020 GO:0030054 GO:0032879 GO:0032991 GO:0044183 GO:0044424 GO:0044444 GO:0044445 GO:0044464 GO:0048518 GO:0050789 GO:0051049 GO:0051050 GO:0051082 GO:0055044 GO:0061077 GO:0065007 GO:0101031

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cpn60_TCP1

Protein Analysis

97

Amino Acids

10.53

Weight (kDa)

8.05

Isoelectric Point (pI)

32.66

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Cpn60_TCP1	PF00118	13 - 63	1.4e-08	TCP-1/cpn60 chaperonin family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	44
AcoI	YGGCCR	1 cut(s)	14
AcsI	RAATTY	2 cut(s)	56, 86
AdeI	CACNNNGTG	1 cut(s)	267
AluBI	AGCT	1 cut(s)	189
AluI	AGCT	1 cut(s)	189
AoxI	GGCC	1 cut(s)	14
ApoI	RAATTY	2 cut(s)	56, 86
AspS9I	GGNCC	1 cut(s)	37
AvaII	GGWCC	1 cut(s)	37
BccI	CCATC	1 cut(s)	6
BfmI	CTRYAG	1 cut(s)	48
Bme18I	GGWCC	1 cut(s)	37
BmgT120I	GGNCC	1 cut(s)	37
BmsI	GCATC	2 cut(s)	69, 161
BpuEI	CTTGAG	1 cut(s)	113
Bse1I	ACTGG	1 cut(s)	40
Bse3DI	GCAATG	1 cut(s)	234
BseGI	GGATG	1 cut(s)	17
BseMI	GCAATG	1 cut(s)	234
BseNI	ACTGG	1 cut(s)	40
BseYI	CCCAGC	1 cut(s)	104
BshFI	GGCC	1 cut(s)	16
BsnI	GGCC	1 cut(s)	16
Bsp143I	GATC	1 cut(s)	123
BspANI	GGCC	1 cut(s)	16
BsrDI	GCAATG	1 cut(s)	234
BsrI	ACTGG	1 cut(s)	40
BssMI	GATC	1 cut(s)	123
BssNAI	GTATAC	1 cut(s)	45
Bst1107I	GTATAC	1 cut(s)	45
Bst4CI	ACNGT	2 cut(s)	49, 209
BstAPI	GCANNNNNTGC	1 cut(s)	59
BstC8I	GCNNGC	1 cut(s)	279
BstF5I	GGATG	1 cut(s)	17
BstKTI	GATC	1 cut(s)	126
BstMBI	GATC	1 cut(s)	123
BstMWI	GCNNNNNNNGC	2 cut(s)	59, 149
BstNSI	RCATGY	1 cut(s)	152
BstSFI	CTRYAG	1 cut(s)	48
BstZ17I	GTATAC	1 cut(s)	45
BsuRI	GGCC	1 cut(s)	16
BtsCI	GGATG	1 cut(s)	17
Cac8I	GCNNGC	1 cut(s)	279
Cfr13I	GGNCC	1 cut(s)	37
CviAII	CATG	2 cut(s)	149, 213
CviJI	RGCY	4 cut(s)	16, 69, 109, 189
CviKI_1	RGCY	4 cut(s)	16, 69, 109, 189
DpnI	GATC	1 cut(s)	125
DpnII	GATC	1 cut(s)	123
DraIII	CACNNNGTG	1 cut(s)	267
EaeI	YGGCCR	1 cut(s)	14
Eco47I	GGWCC	1 cut(s)	37
EcoT22I	ATGCAT	1 cut(s)	154
FaeI	CATG	2 cut(s)	152, 216
FaiI	YATR	9 cut(s)	26, 45, 128, 137, 139, 150, 214, 224, 255
FalI	AAGNNNNNCTT	2 cut(s)	159, 191
FatI	CATG	2 cut(s)	148, 212
FblI	GTMKAC	1 cut(s)	44
FokI	GGATG	1 cut(s)	24
GsaI	CCCAGC	1 cut(s)	108
HaeIII	GGCC	1 cut(s)	16
Hin1II	CATG	2 cut(s)	152, 216
Hpy166II	GTNNAC	1 cut(s)	45
Hpy188I	TCNGA	1 cut(s)	32
Hpy188III	TCNNGA	2 cut(s)	92, 156
Hpy8I	GTNNAC	1 cut(s)	45
HpyCH4III	ACNGT	2 cut(s)	49, 209
HpyCH4V	TGCA	4 cut(s)	6, 116, 152, 239
HpyF10VI	GCNNNNNNNGC	2 cut(s)	59, 149
Hsp92II	CATG	2 cut(s)	152, 216
Kzo9I	GATC	1 cut(s)	123
LpnPI	CCDG	4 cut(s)	53, 90, 141, 267
LweI	GCATC	2 cut(s)	69, 161
MaeIII	GTNAC	2 cut(s)	203, 259
MalI	GATC	1 cut(s)	125
MboI	GATC	1 cut(s)	123
MboII	GAAGA	1 cut(s)	123
MluCI	AATT	2 cut(s)	56, 86
Mph1103I	ATGCAT	1 cut(s)	154
MseI	TTAA	1 cut(s)	111
MwoI	GCNNNNNNNGC	2 cut(s)	59, 149
NdeII	GATC	1 cut(s)	123
NlaIII	CATG	2 cut(s)	152, 216
NmuCI	GTSAC	1 cut(s)	259
NsiI	ATGCAT	1 cut(s)	154
NspI	RCATGY	1 cut(s)	152
PspFI	CCCAGC	1 cut(s)	104
PspPI	GGNCC	1 cut(s)	37
SaqAI	TTAA	1 cut(s)	111
Sau3AI	GATC	1 cut(s)	123
Sau96I	GGNCC	1 cut(s)	37
SetI	ASST	1 cut(s)	191
SfaNI	GCATC	2 cut(s)	69, 161
SfcI	CTRYAG	1 cut(s)	48
SinI	GGWCC	1 cut(s)	37
SmlI	CTYRAG	1 cut(s)	92
SmoI	CTYRAG	1 cut(s)	92
Sse9I	AATT	2 cut(s)	56, 86
TaaI	ACNGT	2 cut(s)	49, 209
TasI	AATT	2 cut(s)	56, 86
Tru1I	TTAA	1 cut(s)	111
Tru9I	TTAA	1 cut(s)	111
TseFI	GTSAC	1 cut(s)	259
Tsp45I	GTSAC	1 cut(s)	259
TspDTI	ATGAA	2 cut(s)	13, 201
TspGWI	ACGGA	1 cut(s)	134
VpaK11BI	GGWCC	1 cut(s)	37
XapI	RAATTY	2 cut(s)	56, 86
XceI	RCATGY	1 cut(s)	152
XmiI	GTMKAC	1 cut(s)	44
Zsp2I	ATGCAT	1 cut(s)	154

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.