Prupe.1G029200_v2.0.a1

Sieve element occlusion

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
N/A
Physical Location & Seq
Forward (+)
2080309 .. 2081933
1625 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G029200.1_v2.0.a1.CDS.3

Sequence Viewer

Length: 645 bp
ATGGGTTCCAATGAGTCACTGGACCAGATCCTTTTGTGGGCAATAGCTTTTGTTTTAATTGTTTATCTCTTGACCTACAAGAAGCCCACAGGTGAGACTGATCGCAACAATGCTCAAGCCTATATGTACCCAATCCGACTAACAATATCTGAATCTTCGGCTATCTTGAGACAATTCATTTTCGATAATTTTGATGTGCCGTTGAACTGGATCATTAACACTTACACTCGCACTCCGACATATCCTAGGAATTTCGATGAACTGAGGGGTAGTAAACTATTCTTGTTCTTTTCAAGTTTGGATATTTCTGAAGATCATATTTTACTTATCAAGTACGTTAACGAGCGGATACAAAGGGAGAGAAGGGATCTGTATAAGACTGTGTGGATCCCCATTGCGGAGAACCTGAATTGGGAGGCACACAGGGTAGACAATTACTTGTTGGGCATTGCGAGAAGACTGTCATGCTACACAGCTAGACCCCACCCAGCATGCATCAGAAACATCAAGGACACGTACCGATTGCATAACAGGAATAATTATTTAGTGCTGGTGGAGATGGACCAAAGGGGGCATGCGAACGAATACGATCCTGACACCACAATTGTAAGGGAAAGAATGGCTCGGTTTGGCTTCAGAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SEO_C SEO_N

Protein Analysis

215

Amino Acids

25.5

Weight (kDa)

8.83

Isoelectric Point (pI)

36.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 346
AccI GTMKAC 1 cut(s) 429
AciI CCGC 2 cut(s) 346, 398
AclWI GGATC 6 cut(s) 22, 218, 375, 382, 395, 584
AcsI RAATTY 1 cut(s) 250
AcuI CTGAAG 2 cut(s) 330, 619
AfaI GTAC 3 cut(s) 128, 335, 518
AfiI CCNNNNNNNGG 3 cut(s) 37, 397, 412
AflIII ACRYGT 1 cut(s) 513
AgsI TTSAA 2 cut(s) 205, 294
AluBI AGCT 2 cut(s) 47, 476
AluI AGCT 2 cut(s) 47, 476
Alw26I GTCTC 2 cut(s) 89, 163
AlwI GGATC 6 cut(s) 22, 218, 375, 382, 395, 584
AlwNI CAGNNNCTG 1 cut(s) 642
ApoI RAATTY 1 cut(s) 250
AspA2I CCTAGG 1 cut(s) 245
AspS9I GGNCC 2 cut(s) 22, 562
AsuHPI GGTGA 1 cut(s) 104
AvaII GGWCC 2 cut(s) 22, 562
AvrII CCTAGG 1 cut(s) 245
BamHI GGATCC 1 cut(s) 387
BbsI GAAGAC 1 cut(s) 463
BccI CCATC 1 cut(s) 553
BceAI ACGGC 1 cut(s) 184
BciVI GTATCC 1 cut(s) 342
BcoDI GTCTC 2 cut(s) 89, 163
BfaI CTAG 2 cut(s) 246, 477
BfuI GTATCC 1 cut(s) 342
BlnI CCTAGG 1 cut(s) 245
Bme18I GGWCC 2 cut(s) 22, 562
BmgT120I GGNCC 2 cut(s) 22, 562
BmiI GGNNCC 2 cut(s) 7, 389
BmsI GCATC 1 cut(s) 504
BpiI GAAGAC 1 cut(s) 463
BpuEI CTTGAG 2 cut(s) 99, 187
BsaAI YACGTR 1 cut(s) 516
BsaJI CCNNGG 1 cut(s) 245
BsaXI ACNNNNNCTCC 2 cut(s) 217, 247
Bsc4I CCNNNNNNNGG 3 cut(s) 37, 397, 412
Bse1I ACTGG 2 cut(s) 24, 212
Bse3DI GCAATG 2 cut(s) 393, 447
BseDI CCNNGG 1 cut(s) 245
BseLI CCNNNNNNNGG 3 cut(s) 37, 397, 412
BseMI GCAATG 2 cut(s) 393, 447
BseMII CTCAG 1 cut(s) 254
BseNI ACTGG 2 cut(s) 24, 212
BseYI CCCAGC 1 cut(s) 487
BslI CCNNNNNNNGG 3 cut(s) 37, 397, 412
BsmAI GTCTC 2 cut(s) 89, 163
Bsp143I GATC 7 cut(s) 27, 100, 210, 313, 367, 387, 589
BspACI CCGC 2 cut(s) 346, 398
BspCNI CTCAG 1 cut(s) 255
BspLI GGNNCC 2 cut(s) 7, 389
BspPI GGATC 6 cut(s) 22, 218, 375, 382, 395, 584
BsrBI CCGCTC 1 cut(s) 346
BsrDI GCAATG 2 cut(s) 393, 447
BsrI ACTGG 2 cut(s) 24, 212
BssECI CCNNGG 1 cut(s) 245
BssMI GATC 7 cut(s) 27, 100, 210, 313, 367, 387, 589
BssT1I CCWWGG 1 cut(s) 245
Bst4CI ACNGT 2 cut(s) 382, 462
BstBAI YACGTR 1 cut(s) 516
BstC8I GCNNGC 2 cut(s) 493, 576
BstDEI CTNAG 1 cut(s) 263
BstKTI GATC 7 cut(s) 30, 103, 213, 316, 370, 390, 592
BstMAI GTCTC 2 cut(s) 89, 163
BstMBI GATC 7 cut(s) 27, 100, 210, 313, 367, 387, 589
BstNSI RCATGY 2 cut(s) 495, 578
BstV2I GAAGAC 1 cut(s) 463
BstX2I RGATCY 3 cut(s) 27, 367, 387
BstYI RGATCY 3 cut(s) 27, 367, 387
BsuI GTATCC 1 cut(s) 342
BtsIMutI CAGTG 1 cut(s) 17
Cac8I GCNNGC 2 cut(s) 493, 576
CaiI CAGNNNCTG 1 cut(s) 642
Cfr13I GGNCC 2 cut(s) 22, 562
Csp6I GTAC 3 cut(s) 127, 334, 517
CviAII CATG 3 cut(s) 465, 492, 575
CviJI RGCY 7 cut(s) 47, 85, 119, 161, 476, 623, 633
CviKI_1 RGCY 7 cut(s) 47, 85, 119, 161, 476, 623, 633
CviQI GTAC 3 cut(s) 127, 334, 517
DdeI CTNAG 1 cut(s) 263
DpnI GATC 7 cut(s) 29, 102, 212, 315, 369, 389, 591
DpnII GATC 7 cut(s) 27, 100, 210, 313, 367, 387, 589
Eco130I CCWWGG 1 cut(s) 245
Eco47I GGWCC 2 cut(s) 22, 562
Eco57I CTGAAG 2 cut(s) 330, 619
EcoT14I CCWWGG 1 cut(s) 245
EcoT22I ATGCAT 1 cut(s) 497
ErhI CCWWGG 1 cut(s) 245
FaeI CATG 3 cut(s) 468, 495, 578
FaiI YATR 9 cut(s) 123, 125, 241, 318, 375, 466, 493, 528, 576
FatI CATG 3 cut(s) 464, 491, 574
FblI GTMKAC 1 cut(s) 429
FspBI CTAG 2 cut(s) 246, 477
GsaI CCCAGC 1 cut(s) 491
Hin1II CATG 3 cut(s) 468, 495, 578
HincII GTYRAC 1 cut(s) 340
HindII GTYRAC 1 cut(s) 340
HinfI GANTC 2 cut(s) 14, 152
HpaI GTTAAC 1 cut(s) 340
HphI GGTGA 1 cut(s) 104
Hpy166II GTNNAC 3 cut(s) 275, 340, 430
Hpy188I TCNGA 6 cut(s) 137, 151, 237, 310, 500, 638
Hpy188III TCNNGA 3 cut(s) 70, 166, 593
Hpy8I GTNNAC 3 cut(s) 275, 340, 430
HpyAV CCTTC 1 cut(s) 357
HpyCH4III ACNGT 2 cut(s) 382, 462
HpyCH4IV ACGT 2 cut(s) 336, 515
HpyCH4V TGCA 2 cut(s) 495, 526
HpyF3I CTNAG 1 cut(s) 263
HpySE526I ACGT 2 cut(s) 336, 515
Hsp92II CATG 3 cut(s) 468, 495, 578
KspAI GTTAAC 1 cut(s) 340
Kzo9I GATC 7 cut(s) 27, 100, 210, 313, 367, 387, 589
LweI GCATC 1 cut(s) 504
MaeI CTAG 2 cut(s) 246, 477
MaeII ACGT 2 cut(s) 336, 515
MaeIII GTNAC 1 cut(s) 15
MalI GATC 7 cut(s) 29, 102, 212, 315, 369, 389, 591
MbiI CCGCTC 1 cut(s) 346
MboI GATC 7 cut(s) 27, 100, 210, 313, 367, 387, 589
MboII GAAGA 3 cut(s) 147, 323, 468
MfeI CAATTG 1 cut(s) 603
MflI RGATCY 3 cut(s) 27, 367, 387
MluCI AATT 8 cut(s) 57, 173, 187, 250, 409, 433, 538, 603
MlyI GAGTC 1 cut(s) 23
MmeI TCCRAC 2 cut(s) 160, 260
MnlI CCTC 2 cut(s) 258, 409
Mph1103I ATGCAT 1 cut(s) 497
MseI TTAA 3 cut(s) 56, 216, 339
MunI CAATTG 1 cut(s) 603
NdeII GATC 7 cut(s) 27, 100, 210, 313, 367, 387, 589
NlaIII CATG 3 cut(s) 468, 495, 578
NlaIV GGNNCC 2 cut(s) 7, 389
NmuCI GTSAC 1 cut(s) 15
NsiI ATGCAT 1 cut(s) 497
NspI RCATGY 2 cut(s) 495, 578
PaeI GCATGC 2 cut(s) 495, 578
PfeI GAWTC 1 cut(s) 152
PleI GAGTC 1 cut(s) 22
PpsI GAGTC 1 cut(s) 22
Ppu21I YACGTR 1 cut(s) 516
PspFI CCCAGC 1 cut(s) 487
PspN4I GGNNCC 2 cut(s) 7, 389
PspPI GGNCC 2 cut(s) 22, 562
PstNI CAGNNNCTG 1 cut(s) 642
PsuI RGATCY 3 cut(s) 27, 367, 387
RsaI GTAC 3 cut(s) 128, 335, 518
RsaNI GTAC 3 cut(s) 127, 334, 517
SaqAI TTAA 3 cut(s) 56, 216, 339
Sau3AI GATC 7 cut(s) 27, 100, 210, 313, 367, 387, 589
Sau96I GGNCC 2 cut(s) 22, 562
SchI GAGTC 1 cut(s) 23
SetI ASST 7 cut(s) 49, 77, 94, 339, 408, 478, 518
SfaNI GCATC 1 cut(s) 504
SinI GGWCC 2 cut(s) 22, 562
SmlI CTYRAG 2 cut(s) 114, 166
SmoI CTYRAG 2 cut(s) 114, 166
SphI GCATGC 2 cut(s) 495, 578
Sse9I AATT 8 cut(s) 57, 173, 187, 250, 409, 433, 538, 603
SsiI CCGC 2 cut(s) 346, 398
SspMI CTAG 2 cut(s) 246, 477
StyI CCWWGG 1 cut(s) 245
TaaI ACNGT 2 cut(s) 382, 462
TaiI ACGT 2 cut(s) 339, 518
TaqI TCGA 2 cut(s) 183, 255
TasI AATT 8 cut(s) 57, 173, 187, 250, 409, 433, 538, 603
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 3 cut(s) 56, 216, 339
Tru9I TTAA 3 cut(s) 56, 216, 339
TscAI CASTG 1 cut(s) 24
TseFI GTSAC 1 cut(s) 15
Tsp45I GTSAC 1 cut(s) 15
TspDTI ATGAA 2 cut(s) 166, 273
TspRI CASTG 1 cut(s) 24
VpaK11BI GGWCC 2 cut(s) 22, 562
XapI RAATTY 1 cut(s) 250
XceI RCATGY 2 cut(s) 495, 578
XcmI CCANNNNNNNNNTGG 1 cut(s) 16
XmaJI CCTAGG 1 cut(s) 245
XmiI GTMKAC 1 cut(s) 429
XspI CTAG 2 cut(s) 246, 477
Zsp2I ATGCAT 1 cut(s) 497
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.