Prupe.1G196100_v2.0.a1

Component of the EKC KEOPS complex that is required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in tRNAs that read codons beginning with adenine. The complex is probably involved in the transfer of the threonylcarbamoyl moiety of threonylcarbamoyl-AMP (TC-AMP) to the N6 group of A37. Likely plays a direct catalytic role in this reaction, but requires other protein(s) of the complex to fulfill this activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
N/A
Physical Location & Seq
Reverse (-)
18726665 .. 18727616
952 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G196100.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 441 bp
ATGAAGAAGATGATAGCTCTAGGGTTTGAGGGTTCAGCCAACAAGATTGGTGTTGGGGTAACAATTTTGGCTCCTTCCCTCGAAACTGCACCGCACCATCTCCAACTCATTCACCCGCTGATTAAATCTGCTTTGGAAACTGCCCAAATAACGCCCAAGGAAATTTATTGCCTTTGTTACACCAAGGGTCCTGGCATGGGAGCACCATTACAACTTTGGAAGAAGCCCATTGTTGCAGTTAATCATTGCAGTGCACATATTGAGATGGGAAGGATTGTGACAGGTGCATATGATCCTGTTGTGTTGTATTTGCTTGCCACATTCGACAGGGTACTAACACTCTCCAATGATCCAAGTCCTGGATATAACATTGAGCAGATGGCCTCTAGTTTTAGAAAAAGGATTGAGTTGCCATATATTTCACATGGTAACTGTTCATAG

Protein Analysis

147

Amino Acids

15.93

Weight (kDa)

8.69

Isoelectric Point (pI)

50.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 359
AciI CCGC 2 cut(s) 92, 116
AclWI GGATC 2 cut(s) 287, 344
AcsI RAATTY 1 cut(s) 162
AfaI GTAC 1 cut(s) 333
AfiI CCNNNNNNNGG 2 cut(s) 197, 359
AjnI CCWGG 2 cut(s) 190, 358
AluBI AGCT 1 cut(s) 17
AluI AGCT 1 cut(s) 17
Alw21I GWGCWC 2 cut(s) 205, 256
Alw44I GTGCAC 1 cut(s) 252
AlwI GGATC 2 cut(s) 287, 344
AoxI GGCC 1 cut(s) 381
ApaLI GTGCAC 1 cut(s) 252
ApoI RAATTY 1 cut(s) 162
AspS9I GGNCC 1 cut(s) 188
AsuHPI GGTGA 1 cut(s) 104
AvaII GGWCC 1 cut(s) 188
BaeGI GKGCMC 1 cut(s) 256
Bbv12I GWGCWC 2 cut(s) 205, 256
BccI CCATC 3 cut(s) 105, 259, 373
BciT130I CCWGG 2 cut(s) 192, 360
BfaI CTAG 2 cut(s) 20, 387
Bme1390I CCNGG 2 cut(s) 192, 360
Bme18I GGWCC 1 cut(s) 188
BmgT120I GGNCC 1 cut(s) 188
BmiI GGNNCC 2 cut(s) 72, 189
BmrFI CCNGG 2 cut(s) 192, 360
BsaJI CCNNGG 2 cut(s) 156, 183
Bsc4I CCNNNNNNNGG 2 cut(s) 197, 359
Bse3DI GCAATG 1 cut(s) 244
BseBI CCWGG 2 cut(s) 192, 360
BseDI CCNNGG 2 cut(s) 156, 183
BseLI CCNNNNNNNGG 2 cut(s) 197, 359
BseMI GCAATG 1 cut(s) 244
BseSI GKGCMC 1 cut(s) 256
BsgI GTGCAG 1 cut(s) 72
BshFI GGCC 1 cut(s) 383
BsiHKAI GWGCWC 2 cut(s) 205, 256
BslI CCNNNNNNNGG 2 cut(s) 197, 359
BsnI GGCC 1 cut(s) 383
Bsp1286I GDGCHC 2 cut(s) 205, 256
Bsp143I GATC 2 cut(s) 292, 349
BspACI CCGC 2 cut(s) 92, 116
BspANI GGCC 1 cut(s) 383
BspLI GGNNCC 2 cut(s) 72, 189
BspPI GGATC 2 cut(s) 287, 344
BsrDI GCAATG 1 cut(s) 244
BssECI CCNNGG 2 cut(s) 156, 183
BssMI GATC 2 cut(s) 292, 349
BssT1I CCWWGG 2 cut(s) 156, 183
Bst2UI CCWGG 2 cut(s) 192, 360
Bst4CI ACNGT 1 cut(s) 434
BstC8I GCNNGC 1 cut(s) 315
BstKTI GATC 2 cut(s) 295, 352
BstMBI GATC 2 cut(s) 292, 349
BstNI CCWGG 2 cut(s) 192, 360
BstSCI CCNGG 2 cut(s) 190, 358
BstSLI GKGCMC 1 cut(s) 256
BsuRI GGCC 1 cut(s) 383
BtsI GCAGTG 1 cut(s) 256
BtsIMutI CAGTG 1 cut(s) 256
Cac8I GCNNGC 1 cut(s) 315
Cfr13I GGNCC 1 cut(s) 188
Csp6I GTAC 1 cut(s) 332
CviAII CATG 2 cut(s) 196, 425
CviJI RGCY 5 cut(s) 17, 38, 71, 226, 383
CviKI_1 RGCY 5 cut(s) 17, 38, 71, 226, 383
CviQI GTAC 1 cut(s) 332
DpnI GATC 2 cut(s) 294, 351
DpnII GATC 2 cut(s) 292, 349
Eco130I CCWWGG 2 cut(s) 156, 183
Eco47I GGWCC 1 cut(s) 188
EcoO109I RGGNCCY 1 cut(s) 188
EcoRII CCWGG 2 cut(s) 190, 358
EcoT14I CCWWGG 2 cut(s) 156, 183
ErhI CCWWGG 2 cut(s) 156, 183
FaeI CATG 2 cut(s) 199, 428
FaiI YATR 9 cut(s) 197, 258, 289, 291, 366, 415, 417, 426, 439
FatI CATG 2 cut(s) 195, 424
FauI CCCGC 1 cut(s) 123
FauNDI CATATG 1 cut(s) 289
FspBI CTAG 2 cut(s) 20, 387
HaeIII GGCC 1 cut(s) 383
Hin1II CATG 2 cut(s) 199, 428
HphI GGTGA 1 cut(s) 104
Hpy166II GTNNAC 1 cut(s) 254
Hpy8I GTNNAC 1 cut(s) 254
HpyAV CCTTC 2 cut(s) 84, 264
HpyCH4III ACNGT 1 cut(s) 434
HpyCH4V TGCA 5 cut(s) 89, 236, 249, 254, 287
Hsp92II CATG 2 cut(s) 199, 428
Kzo9I GATC 2 cut(s) 292, 349
LmnI GCTCC 2 cut(s) 76, 200
LpnPI CCDG 7 cut(s) 177, 204, 267, 309, 313, 345, 372
MaeI CTAG 2 cut(s) 20, 387
MaeIII GTNAC 4 cut(s) 58, 176, 277, 428
MalI GATC 2 cut(s) 294, 351
MboI GATC 2 cut(s) 292, 349
MboII GAAGA 3 cut(s) 16, 19, 232
MhlI GDGCHC 2 cut(s) 205, 256
MluCI AATT 2 cut(s) 63, 162
MmeI TCCRAC 1 cut(s) 127
MnlI CCTC 3 cut(s) 22, 89, 394
MseI TTAA 2 cut(s) 123, 240
MslI CAYNNNNRTG 1 cut(s) 249
MspA1I CMGCKG 1 cut(s) 118
MspR9I CCNGG 2 cut(s) 192, 360
MvaI CCWGG 2 cut(s) 192, 360
NdeI CATATG 1 cut(s) 289
NdeII GATC 2 cut(s) 292, 349
NlaIII CATG 2 cut(s) 199, 428
NlaIV GGNNCC 2 cut(s) 72, 189
NmuCI GTSAC 1 cut(s) 277
PflMI CCANNNNNTGG 1 cut(s) 359
PfoI TCCNGGA 1 cut(s) 358
PpuMI RGGWCCY 1 cut(s) 188
Psp5II RGGWCCY 1 cut(s) 188
Psp6I CCWGG 2 cut(s) 190, 358
PspGI CCWGG 2 cut(s) 190, 358
PspN4I GGNNCC 2 cut(s) 72, 189
PspPI GGNCC 1 cut(s) 188
PspPPI RGGWCCY 1 cut(s) 188
RsaI GTAC 1 cut(s) 333
RsaNI GTAC 1 cut(s) 332
RseI CAYNNNNRTG 1 cut(s) 249
SaqAI TTAA 2 cut(s) 123, 240
Sau3AI GATC 2 cut(s) 292, 349
Sau96I GGNCC 1 cut(s) 188
ScrFI CCNGG 2 cut(s) 192, 360
SduI GDGCHC 2 cut(s) 205, 256
SetI ASST 2 cut(s) 19, 286
SinI GGWCC 1 cut(s) 188
SmiMI CAYNNNNRTG 1 cut(s) 249
Sse9I AATT 2 cut(s) 63, 162
SsiI CCGC 2 cut(s) 92, 116
SspMI CTAG 2 cut(s) 20, 387
StyD4I CCNGG 2 cut(s) 190, 358
StyI CCWWGG 2 cut(s) 156, 183
TaaI ACNGT 1 cut(s) 434
TaqI TCGA 2 cut(s) 81, 324
TasI AATT 2 cut(s) 63, 162
Tru1I TTAA 2 cut(s) 123, 240
Tru9I TTAA 2 cut(s) 123, 240
TscAI CASTG 1 cut(s) 256
TseFI GTSAC 1 cut(s) 277
Tsp45I GTSAC 1 cut(s) 277
TspDTI ATGAA 2 cut(s) 17, 426
TspRI CASTG 1 cut(s) 256
Van91I CCANNNNNTGG 1 cut(s) 359
VneI GTGCAC 1 cut(s) 252
VpaK11BI GGWCC 1 cut(s) 188
XapI RAATTY 1 cut(s) 162
XcmI CCANNNNNNNNNTGG 1 cut(s) 213
XspI CTAG 2 cut(s) 20, 387
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.