Prupe.1G229400_v2.0.a1

iron ion binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
N/A
Physical Location & Seq
Forward (+)
24239450 .. 24239800
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G229400.1_v2.0.a1.CDS.2

Sequence Viewer

Length: 300 bp
ATGTCGACCCAAGACGTGAACATAGACAGCTACAGCATCAAGGACAACGCACAAGTCATAGTGAACGCATGGCAGATCGGAAGAGACCCCGAAACCTACGACAAGCCGGAGGAGTTCGAGCCCGAACGTTTCTTGAATAGCACCAGGGGTCTGCCCAGGGATTCAGTTTCCATGGCGCTTAAAGAGATTGCTTTGGCAAATTTGGTGCATAAGTTTGATTGGGAGTTGCCCTGGGGTGCCGGTGGGGAGGACTTAGACATGAACCAATGGCGCGTTCCTACACAGGAAATGTCCTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00460 ko01110 map00460 map01110
Pfam Domains
Protein Families
p450

Protein Analysis

100

Amino Acids

11.36

Weight (kDa)

4.36

Isoelectric Point (pI)

49.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 236
AccI GTMKAC 1 cut(s) 5
AccII CGCG 1 cut(s) 273
AclI AACGTT 1 cut(s) 127
AcsI RAATTY 1 cut(s) 199
AgsI TTSAA 1 cut(s) 136
AjiI CACGTC 1 cut(s) 16
AjnI CCWGG 3 cut(s) 143, 155, 230
AjuI GAANNNNNNNTTGG 2 cut(s) 258, 290
AluBI AGCT 1 cut(s) 30
AluI AGCT 1 cut(s) 30
Alw26I GTCTC 1 cut(s) 78
ApoI RAATTY 1 cut(s) 199
AspLEI GCGC 2 cut(s) 178, 273
BanI GGYRCC 1 cut(s) 236
BanII GRGCYC 1 cut(s) 123
BciT130I CCWGG 3 cut(s) 145, 157, 232
BcoDI GTCTC 1 cut(s) 78
BfmI CTRYAG 1 cut(s) 31
BfoI RGCGCY 1 cut(s) 179
Bme1390I CCNGG 3 cut(s) 145, 157, 232
BmgBI CACGTC 1 cut(s) 16
BmiI GGNNCC 1 cut(s) 238
BmrFI CCNGG 3 cut(s) 145, 157, 232
BmsI GCATC 1 cut(s) 45
BsaI GGTCTC 1 cut(s) 78
BsaJI CCNNGG 6 cut(s) 144, 155, 156, 171, 230, 231
Bse118I RCCGGY 1 cut(s) 239
BseBI CCWGG 3 cut(s) 145, 157, 232
BseDI CCNNGG 6 cut(s) 144, 155, 156, 171, 230, 231
BseRI GAGGAG 1 cut(s) 125
Bsh1236I CGCG 1 cut(s) 273
BshNI GGYRCC 1 cut(s) 236
BsiSI CCGG 2 cut(s) 107, 240
BsmAI GTCTC 1 cut(s) 78
Bso31I GGTCTC 1 cut(s) 78
Bsp1286I GDGCHC 1 cut(s) 123
Bsp143I GATC 1 cut(s) 75
Bsp19I CCATGG 1 cut(s) 171
BspFNI CGCG 1 cut(s) 273
BspLI GGNNCC 1 cut(s) 238
BspT107I GGYRCC 1 cut(s) 236
BspTNI GGTCTC 1 cut(s) 78
BsrFI RCCGGY 1 cut(s) 239
BssAI RCCGGY 1 cut(s) 239
BssECI CCNNGG 6 cut(s) 144, 155, 156, 171, 230, 231
BssMI GATC 1 cut(s) 75
BssT1I CCWWGG 1 cut(s) 171
Bst2UI CCWGG 3 cut(s) 145, 157, 232
Bst6I CTCTTC 1 cut(s) 76
BstDEI CTNAG 1 cut(s) 253
BstDSI CCRYGG 1 cut(s) 171
BstFNI CGCG 1 cut(s) 273
BstH2I RGCGCY 1 cut(s) 179
BstHHI GCGC 2 cut(s) 178, 273
BstKTI GATC 1 cut(s) 78
BstMAI GTCTC 1 cut(s) 78
BstMBI GATC 1 cut(s) 75
BstNI CCWGG 3 cut(s) 145, 157, 232
BstSCI CCNGG 3 cut(s) 143, 155, 230
BstSFI CTRYAG 1 cut(s) 31
BstUI CGCG 1 cut(s) 273
BtgI CCRYGG 1 cut(s) 171
BtrI CACGTC 1 cut(s) 16
CfoI GCGC 2 cut(s) 178, 273
Cfr10I RCCGGY 1 cut(s) 239
CviAII CATG 3 cut(s) 69, 172, 259
CviJI RGCY 3 cut(s) 30, 106, 121
CviKI_1 RGCY 3 cut(s) 30, 106, 121
DdeI CTNAG 1 cut(s) 253
DpnI GATC 1 cut(s) 77
DpnII GATC 1 cut(s) 75
Eam1104I CTCTTC 1 cut(s) 76
EarI CTCTTC 1 cut(s) 76
Eco130I CCWWGG 1 cut(s) 171
Eco24I GRGCYC 1 cut(s) 123
Eco31I GGTCTC 1 cut(s) 78
EcoRII CCWGG 3 cut(s) 143, 155, 230
EcoT14I CCWWGG 1 cut(s) 171
EcoT38I GRGCYC 1 cut(s) 123
ErhI CCWWGG 1 cut(s) 171
FaeI CATG 3 cut(s) 72, 175, 262
FaiI YATR 6 cut(s) 23, 59, 70, 173, 210, 260
FatI CATG 3 cut(s) 68, 171, 258
FblI GTMKAC 1 cut(s) 5
FriOI GRGCYC 1 cut(s) 123
GlaI GCGC 2 cut(s) 177, 272
HaeII RGCGCY 1 cut(s) 179
HapII CCGG 2 cut(s) 107, 240
HhaI GCGC 2 cut(s) 178, 273
Hin1II CATG 3 cut(s) 72, 175, 262
Hin6I GCGC 2 cut(s) 176, 271
HinP1I GCGC 2 cut(s) 176, 271
HincII GTYRAC 1 cut(s) 6
HindII GTYRAC 1 cut(s) 6
HinfI GANTC 1 cut(s) 161
HpaII CCGG 2 cut(s) 107, 240
Hpy166II GTNNAC 3 cut(s) 6, 19, 64
Hpy188I TCNGA 1 cut(s) 80
Hpy188III TCNNGA 1 cut(s) 133
Hpy8I GTNNAC 3 cut(s) 6, 19, 64
HpyCH4IV ACGT 2 cut(s) 15, 127
HpyCH4V TGCA 1 cut(s) 208
HpyF3I CTNAG 1 cut(s) 253
HpySE526I ACGT 2 cut(s) 15, 127
Hsp92II CATG 3 cut(s) 72, 175, 262
HspAI GCGC 2 cut(s) 176, 271
Kzo9I GATC 1 cut(s) 75
LpnPI CCDG 9 cut(s) 120, 130, 142, 157, 169, 217, 244, 253, 269
LweI GCATC 1 cut(s) 45
MaeII ACGT 2 cut(s) 15, 127
MalI GATC 1 cut(s) 77
MboI GATC 1 cut(s) 75
MboII GAAGA 1 cut(s) 93
MhlI GDGCHC 1 cut(s) 123
MluCI AATT 1 cut(s) 199
MnlI CCTC 2 cut(s) 103, 241
MseI TTAA 2 cut(s) 180, 298
MspI CCGG 2 cut(s) 107, 240
MspR9I CCNGG 3 cut(s) 145, 157, 232
MvaI CCWGG 3 cut(s) 145, 157, 232
MvnI CGCG 1 cut(s) 273
NcoI CCATGG 1 cut(s) 171
NdeII GATC 1 cut(s) 75
NlaIII CATG 3 cut(s) 72, 175, 262
NlaIV GGNNCC 1 cut(s) 238
PasI CCCWGGG 2 cut(s) 156, 231
PfeI GAWTC 1 cut(s) 161
Psp1406I AACGTT 1 cut(s) 127
Psp6I CCWGG 3 cut(s) 143, 155, 230
PspGI CCWGG 3 cut(s) 143, 155, 230
PspN4I GGNNCC 1 cut(s) 238
SalI GTCGAC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 180, 298
Sau3AI GATC 1 cut(s) 75
ScrFI CCNGG 3 cut(s) 145, 157, 232
SduI GDGCHC 1 cut(s) 123
SetI ASST 4 cut(s) 18, 32, 98, 130
SfaNI GCATC 1 cut(s) 45
SfcI CTRYAG 1 cut(s) 31
Sse9I AATT 1 cut(s) 199
StyD4I CCNGG 3 cut(s) 143, 155, 230
StyI CCWWGG 1 cut(s) 171
TaiI ACGT 2 cut(s) 18, 130
TaqI TCGA 2 cut(s) 5, 117
TasI AATT 1 cut(s) 199
TfiI GAWTC 1 cut(s) 161
Tru1I TTAA 2 cut(s) 180, 298
Tru9I TTAA 2 cut(s) 180, 298
TspDTI ATGAA 1 cut(s) 275
XapI RAATTY 1 cut(s) 199
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.