Prupe.1G231100_v2.0.a1

Nodulin-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
N/A
Physical Location & Seq
Forward (+)
24598200 .. 24599220
1021 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G231100.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 291 bp
ATGAACACGGAGATTCTGGTGACGTGCATCAAAAACTTCAGGCGAAACCGGGGACCCGTTTCGGGGATTTTGAAAGGTTATGTGGGTCTGAGCACCGTCGCCACCGACCTCGTCGAGATCCAGATCAACTCGTCCGTGCTTAACTACGAGTTCATAACCCACAGACTCGGCCTCATCCCATTGACATCCGACCAGCAAATAGGTTCTTGGGGCTGTTGTCAGATATGGAGGTTTCAAACAATATTAATTCTTCTCAGAGCAAAAGCTTTGGGGGCCTTGAAACTGCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Nodulin-like

Protein Analysis

97

Amino Acids

10.72

Weight (kDa)

9.57

Isoelectric Point (pI)

24.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 112
AcuI CTGAAG 1 cut(s) 22
AfiI CCNNNNNNNGG 2 cut(s) 62, 63
AgsI TTSAA 3 cut(s) 73, 236, 280
AjiI CACGTC 1 cut(s) 24
AluBI AGCT 1 cut(s) 266
AluI AGCT 1 cut(s) 266
Alw21I GWGCWC 1 cut(s) 95
AlwI GGATC 1 cut(s) 112
AoxI GGCC 2 cut(s) 169, 273
AseI ATTAAT 1 cut(s) 245
AspS9I GGNCC 2 cut(s) 53, 273
AsuC2I CCSGG 1 cut(s) 50
AsuHPI GGTGA 1 cut(s) 31
AvaII GGWCC 1 cut(s) 53
Bbv12I GWGCWC 1 cut(s) 95
BcnI CCSGG 1 cut(s) 50
Bme1390I CCNGG 1 cut(s) 50
Bme18I GGWCC 1 cut(s) 53
BmgBI CACGTC 1 cut(s) 24
BmgT120I GGNCC 2 cut(s) 53, 273
BmiI GGNNCC 3 cut(s) 54, 55, 274
BmrFI CCNGG 1 cut(s) 50
BmsI GCATC 1 cut(s) 36
BpuMI CCSGG 1 cut(s) 50
BsaBI GATNNNNATC 1 cut(s) 122
BsaJI CCNNGG 1 cut(s) 49
Bsc4I CCNNNNNNNGG 2 cut(s) 62, 63
Bse8I GATNNNNATC 1 cut(s) 122
BseDI CCNNGG 1 cut(s) 49
BseGI GGATG 2 cut(s) 174, 185
BseJI GATNNNNATC 1 cut(s) 122
BseLI CCNNNNNNNGG 2 cut(s) 62, 63
BseMII CTCAG 2 cut(s) 80, 268
BshFI GGCC 2 cut(s) 171, 275
BsiHKAI GWGCWC 1 cut(s) 95
BsiSI CCGG 1 cut(s) 49
BslFI GGGAC 1 cut(s) 66
BslI CCNNNNNNNGG 2 cut(s) 62, 63
BsmFI GGGAC 1 cut(s) 66
BsnI GGCC 2 cut(s) 171, 275
Bsp1286I GDGCHC 1 cut(s) 95
Bsp143I GATC 2 cut(s) 117, 123
BspANI GGCC 2 cut(s) 171, 275
BspCNI CTCAG 2 cut(s) 81, 267
BspLI GGNNCC 3 cut(s) 54, 55, 274
BspPI GGATC 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 49
BssMI GATC 2 cut(s) 117, 123
Bst4CI ACNGT 1 cut(s) 97
BstDEI CTNAG 2 cut(s) 89, 254
BstF5I GGATG 2 cut(s) 174, 185
BstKTI GATC 2 cut(s) 120, 126
BstMBI GATC 2 cut(s) 117, 123
BstMWI GCNNNNNNNGC 1 cut(s) 272
BstSCI CCNGG 1 cut(s) 48
BstX2I RGATCY 1 cut(s) 117
BstYI RGATCY 1 cut(s) 117
BsuRI GGCC 2 cut(s) 171, 275
BtrI CACGTC 1 cut(s) 24
BtsCI GGATG 2 cut(s) 174, 185
Cfr13I GGNCC 2 cut(s) 53, 273
CviJI RGCY 4 cut(s) 171, 213, 266, 275
CviKI_1 RGCY 4 cut(s) 171, 213, 266, 275
DdeI CTNAG 2 cut(s) 89, 254
DpnI GATC 2 cut(s) 119, 125
DpnII GATC 2 cut(s) 117, 123
Eco47I GGWCC 1 cut(s) 53
Eco57I CTGAAG 1 cut(s) 22
EcoO109I RGGNCCY 2 cut(s) 53, 273
FaiI YATR 3 cut(s) 81, 155, 226
FaqI GGGAC 1 cut(s) 66
FokI GGATG 2 cut(s) 161, 172
HaeIII GGCC 2 cut(s) 171, 275
HapII CCGG 1 cut(s) 49
HindIII AAGCTT 1 cut(s) 264
HinfI GANTC 2 cut(s) 13, 165
HpaII CCGG 1 cut(s) 49
HphI GGTGA 1 cut(s) 31
Hpy188I TCNGA 4 cut(s) 90, 190, 222, 257
Hpy188III TCNNGA 2 cut(s) 115, 121
Hpy99I CGWCG 2 cut(s) 101, 116
HpyCH4III ACNGT 1 cut(s) 97
HpyCH4IV ACGT 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 27
HpyF10VI GCNNNNNNNGC 1 cut(s) 272
HpyF3I CTNAG 2 cut(s) 89, 254
HpySE526I ACGT 1 cut(s) 23
KflI GGGWCCC 1 cut(s) 53
Kzo9I GATC 2 cut(s) 117, 123
LpnPI CCDG 5 cut(s) 2, 25, 62, 134, 206
LweI GCATC 1 cut(s) 36
MaeII ACGT 1 cut(s) 23
MaeIII GTNAC 1 cut(s) 19
MalI GATC 2 cut(s) 119, 125
MboI GATC 2 cut(s) 117, 123
MboII GAAGA 1 cut(s) 242
MflI RGATCY 1 cut(s) 117
MhlI GDGCHC 1 cut(s) 95
MluCI AATT 1 cut(s) 246
MlyI GAGTC 1 cut(s) 159
MmeI TCCRAC 1 cut(s) 213
MnlI CCTC 3 cut(s) 119, 182, 222
MseI TTAA 2 cut(s) 141, 245
MspI CCGG 1 cut(s) 49
MspR9I CCNGG 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 272
NciI CCSGG 1 cut(s) 50
NdeII GATC 2 cut(s) 117, 123
NlaIV GGNNCC 3 cut(s) 54, 55, 274
NmeAIII GCCGAG 1 cut(s) 147
NmuCI GTSAC 1 cut(s) 19
PfeI GAWTC 1 cut(s) 13
PflFI GACNNNGTC 1 cut(s) 110
PleI GAGTC 1 cut(s) 159
PpsI GAGTC 1 cut(s) 159
PpuMI RGGWCCY 1 cut(s) 53
PshBI ATTAAT 1 cut(s) 245
Psp5II RGGWCCY 1 cut(s) 53
PspN4I GGNNCC 3 cut(s) 54, 55, 274
PspPI GGNCC 2 cut(s) 53, 273
PspPPI RGGWCCY 1 cut(s) 53
PsuI RGATCY 1 cut(s) 117
PsyI GACNNNGTC 1 cut(s) 110
SaqAI TTAA 2 cut(s) 141, 245
Sau3AI GATC 2 cut(s) 117, 123
Sau96I GGNCC 2 cut(s) 53, 273
SchI GAGTC 1 cut(s) 159
ScrFI CCNGG 1 cut(s) 50
SduI GDGCHC 1 cut(s) 95
SetI ASST 6 cut(s) 26, 79, 111, 205, 233, 268
SfaNI GCATC 1 cut(s) 36
SinI GGWCC 1 cut(s) 53
Sse9I AATT 1 cut(s) 246
SspI AATATT 1 cut(s) 243
StyD4I CCNGG 1 cut(s) 48
TaaI ACNGT 1 cut(s) 97
TaiI ACGT 1 cut(s) 26
TaqI TCGA 1 cut(s) 114
TasI AATT 1 cut(s) 246
TfiI GAWTC 1 cut(s) 13
Tru1I TTAA 2 cut(s) 141, 245
Tru9I TTAA 2 cut(s) 141, 245
TseFI GTSAC 1 cut(s) 19
Tsp45I GTSAC 1 cut(s) 19
TspDTI ATGAA 2 cut(s) 17, 142
TspGWI ACGGA 2 cut(s) 23, 124
Tth111I GACNNNGTC 1 cut(s) 110
VpaK11BI GGWCC 1 cut(s) 53
VspI ATTAAT 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.