Prupe.1G415300_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
N/A
Physical Location & Seq
Reverse (-)
36105682 .. 36106784
1103 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G415300.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 201 bp
ATGGCAGTCTCAAAGGCAACTTCACTCGTGGCTCTCATGGCGGTCTTCGTCACCGTCCTTTCTGTCATCGGCGCCGCTCAGGCCGCCGAATCTCCAGCTCCTAGCCCAACCTCCGCATCCGCCTCCATCTCCCCGTCGTTCATCTCTGCTTTCGCCGCCGCCTTCGCCGCTATCGTCTTCGGATCTGCGCTCAGGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0016020 GO:0031224 GO:0031225 GO:0044425
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

6.39

Weight (kDa)

8.5

Isoelectric Point (pI)

47.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 71
AccBSI CCGCTC 1 cut(s) 77
AciI CCGC 8 cut(s) 41, 75, 84, 114, 120, 156, 159, 168
AclWI GGATC 1 cut(s) 190
AcyI GRCGYC 1 cut(s) 72
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
Alw26I GTCTC 1 cut(s) 13
AlwI GGATC 1 cut(s) 190
AoxI GGCC 1 cut(s) 81
AspLEI GCGC 2 cut(s) 74, 190
AsuHPI GGTGA 1 cut(s) 43
BanI GGYRCC 1 cut(s) 71
BauI CACGAG 1 cut(s) 26
BbsI GAAGAC 2 cut(s) 37, 169
BccI CCATC 1 cut(s) 134
BcoDI GTCTC 1 cut(s) 13
BfaI CTAG 1 cut(s) 102
BfoI RGCGCY 1 cut(s) 75
BglI GCCNNNNNGGC 1 cut(s) 80
BisI GCNGC 5 cut(s) 75, 84, 156, 159, 168
BlsI GCNGC 5 cut(s) 76, 85, 157, 160, 169
BmiI GGNNCC 1 cut(s) 73
BmsI GCATC 1 cut(s) 125
BpiI GAAGAC 2 cut(s) 37, 169
BpmI CTGGAG 1 cut(s) 78
Bpu10I CCTNAGC 2 cut(s) 78, 191
BsaHI GRCGYC 1 cut(s) 72
BseGI GGATG 1 cut(s) 116
BseMII CTCAG 1 cut(s) 92
BshFI GGCC 1 cut(s) 83
BshNI GGYRCC 1 cut(s) 71
BsmAI GTCTC 1 cut(s) 13
BsnI GGCC 1 cut(s) 83
Bsp143I GATC 1 cut(s) 182
BspACI CCGC 8 cut(s) 41, 75, 84, 114, 120, 156, 159, 168
BspANI GGCC 1 cut(s) 83
BspCNI CTCAG 1 cut(s) 91
BspLI GGNNCC 1 cut(s) 73
BspPI GGATC 1 cut(s) 190
BspT107I GGYRCC 1 cut(s) 71
BsrBI CCGCTC 1 cut(s) 77
BssMI GATC 1 cut(s) 182
BssNI GRCGYC 1 cut(s) 72
BssSI CACGAG 1 cut(s) 26
Bst2BI CACGAG 1 cut(s) 26
Bst4CI ACNGT 1 cut(s) 55
BstACI GRCGYC 1 cut(s) 72
BstDEI CTNAG 2 cut(s) 78, 191
BstF5I GGATG 1 cut(s) 116
BstH2I RGCGCY 1 cut(s) 75
BstHHI GCGC 2 cut(s) 74, 190
BstKTI GATC 1 cut(s) 185
BstMAI GTCTC 1 cut(s) 13
BstMBI GATC 1 cut(s) 182
BstMWI GCNNNNNNNGC 6 cut(s) 38, 80, 83, 155, 164, 167
BstV2I GAAGAC 2 cut(s) 37, 169
BstX2I RGATCY 1 cut(s) 182
BstYI RGATCY 1 cut(s) 182
BsuRI GGCC 1 cut(s) 83
BtsCI GGATG 1 cut(s) 116
CfoI GCGC 2 cut(s) 74, 190
CviAII CATG 1 cut(s) 37
CviJI RGCY 4 cut(s) 32, 83, 98, 105
CviKI_1 RGCY 4 cut(s) 32, 83, 98, 105
DdeI CTNAG 2 cut(s) 78, 191
DinI GGCGCC 1 cut(s) 73
DpnI GATC 1 cut(s) 184
DpnII GATC 1 cut(s) 182
EciI GGCGGA 1 cut(s) 109
EgeI GGCGCC 1 cut(s) 73
EheI GGCGCC 1 cut(s) 73
FaeI CATG 1 cut(s) 40
FaiI YATR 1 cut(s) 38
FatI CATG 1 cut(s) 36
Fnu4HI GCNGC 5 cut(s) 75, 84, 156, 159, 168
FokI GGATG 1 cut(s) 103
Fsp4HI GCNGC 5 cut(s) 75, 84, 156, 159, 168
FspBI CTAG 1 cut(s) 102
GlaI GCGC 2 cut(s) 73, 189
GluI GCNGC 5 cut(s) 75, 84, 156, 159, 168
GsuI CTGGAG 1 cut(s) 78
HaeII RGCGCY 1 cut(s) 75
HaeIII GGCC 1 cut(s) 83
HhaI GCGC 2 cut(s) 74, 190
Hin1I GRCGYC 1 cut(s) 72
Hin1II CATG 1 cut(s) 40
Hin6I GCGC 2 cut(s) 72, 188
HinP1I GCGC 2 cut(s) 72, 188
HinfI GANTC 1 cut(s) 89
HphI GGTGA 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 182
Hpy99I CGWCG 1 cut(s) 139
HpyAV CCTTC 1 cut(s) 172
HpyCH4III ACNGT 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 6 cut(s) 38, 80, 83, 155, 164, 167
HpyF3I CTNAG 2 cut(s) 78, 191
Hsp92I GRCGYC 1 cut(s) 72
Hsp92II CATG 1 cut(s) 40
HspAI GCGC 2 cut(s) 72, 188
KasI GGCGCC 1 cut(s) 71
Kzo9I GATC 1 cut(s) 182
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 3 cut(s) 65, 108, 178
LweI GCATC 1 cut(s) 125
MaeI CTAG 1 cut(s) 102
MaeIII GTNAC 1 cut(s) 49
MalI GATC 1 cut(s) 184
MbiI CCGCTC 1 cut(s) 77
MboI GATC 1 cut(s) 182
MboII GAAGA 2 cut(s) 37, 169
MflI RGATCY 1 cut(s) 182
Mly113I GGCGCC 1 cut(s) 72
MnlI CCTC 2 cut(s) 121, 133
MwoI GCNNNNNNNGC 6 cut(s) 38, 80, 83, 155, 164, 167
NarI GGCGCC 1 cut(s) 72
NdeII GATC 1 cut(s) 182
NlaIII CATG 1 cut(s) 40
NlaIV GGNNCC 1 cut(s) 73
NmuCI GTSAC 1 cut(s) 49
PcsI WCGNNNNNNNCGW 1 cut(s) 171
PfeI GAWTC 1 cut(s) 89
PkrI GCNGC 5 cut(s) 76, 85, 157, 160, 169
PluTI GGCGCC 1 cut(s) 75
PspN4I GGNNCC 1 cut(s) 73
PsuI RGATCY 1 cut(s) 182
SatI GCNGC 5 cut(s) 75, 84, 156, 159, 168
Sau3AI GATC 1 cut(s) 182
SetI ASST 2 cut(s) 100, 113
SfaNI GCATC 1 cut(s) 125
SfoI GGCGCC 1 cut(s) 73
SgeI CNNG 7 cut(s) 38, 40, 49, 92, 107, 114, 145
SsiI CCGC 8 cut(s) 41, 75, 84, 114, 120, 156, 159, 168
SspDI GGCGCC 1 cut(s) 71
SspMI CTAG 1 cut(s) 102
TaaI ACNGT 1 cut(s) 55
TauI GCSGC 5 cut(s) 77, 86, 158, 161, 170
TfiI GAWTC 1 cut(s) 89
TseFI GTSAC 1 cut(s) 49
Tsp45I GTSAC 1 cut(s) 49
TspDTI ATGAA 1 cut(s) 130
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.