Prupe.3G064000_v2.0.a1
HSP70 Family

Belongs to the heat shock protein 70 family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
N/A
Physical Location & Seq
Forward (+)
4575935 .. 4576183
249 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G064000.1

Sequence Viewer

Length: 249 bp
ATGGTTTGTGTAGGAGTTTTTTTTGGCTGCTTACGACCCCGTTCTGTCAAAGGTTATATTCTCTCAGCCTTGGCCATAATTGGCATTCTATTTGGCTTGCGAATCCTTTGTTACATCGTCTATCGGTGCTTCAAGAGGGAAATGCAGCATCCTCACAGCCCTCGCATCGAGCAAAACCCAAACGATGGGTTGGAAATGCAGCCATGGGAGATTCATGCTCACCACCCTGCAACTATGAGCAGAAATTAG
Functional Annotation

Protein Analysis

83

Amino Acids

9.47

Weight (kDa)

9.16

Isoelectric Point (pI)

49.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 185
AcoI YGGCCR 1 cut(s) 72
AfiI CCNNNNNNNGG 1 cut(s) 185
AgsI TTSAA 1 cut(s) 133
AoxI GGCC 1 cut(s) 72
ApeKI GCWGC 3 cut(s) 27, 145, 199
AsuHPI GGTGA 1 cut(s) 212
BalI TGGCCA 1 cut(s) 74
BbvI GCAGC 3 cut(s) 14, 157, 211
BccI CCATC 1 cut(s) 179
BisI GCNGC 3 cut(s) 28, 146, 200
BlsI GCNGC 3 cut(s) 29, 147, 201
BmsI GCATC 2 cut(s) 157, 174
BsaJI CCNNGG 2 cut(s) 69, 203
Bsc4I CCNNNNNNNGG 1 cut(s) 185
BseDI CCNNGG 2 cut(s) 69, 203
BseGI GGATG 1 cut(s) 148
BseLI CCNNNNNNNGG 1 cut(s) 185
BseMII CTCAG 1 cut(s) 78
BseXI GCAGC 3 cut(s) 14, 157, 211
BshFI GGCC 1 cut(s) 74
BslI CCNNNNNNNGG 1 cut(s) 185
BsmI GAATGC 1 cut(s) 84
BsnI GGCC 1 cut(s) 74
Bsp19I CCATGG 1 cut(s) 203
BspANI GGCC 1 cut(s) 74
BspCNI CTCAG 1 cut(s) 77
BssECI CCNNGG 2 cut(s) 69, 203
BssT1I CCWWGG 2 cut(s) 69, 203
BstC8I GCNNGC 1 cut(s) 98
BstDEI CTNAG 1 cut(s) 64
BstDSI CCRYGG 1 cut(s) 203
BstF5I GGATG 1 cut(s) 148
BstV1I GCAGC 3 cut(s) 14, 157, 211
BsuRI GGCC 1 cut(s) 74
BtgI CCRYGG 1 cut(s) 203
BtsCI GGATG 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 98
CviAII CATG 2 cut(s) 204, 215
CviJI RGCY 6 cut(s) 27, 68, 74, 96, 159, 202
CviKI_1 RGCY 6 cut(s) 27, 68, 74, 96, 159, 202
DdeI CTNAG 1 cut(s) 64
EaeI YGGCCR 1 cut(s) 72
Eco130I CCWWGG 2 cut(s) 69, 203
EcoT14I CCWWGG 2 cut(s) 69, 203
ErhI CCWWGG 2 cut(s) 69, 203
FaeI CATG 2 cut(s) 207, 218
FaiI YATR 5 cut(s) 57, 77, 205, 216, 236
FatI CATG 2 cut(s) 203, 214
Fnu4HI GCNGC 3 cut(s) 28, 146, 200
FokI GGATG 1 cut(s) 135
Fsp4HI GCNGC 3 cut(s) 28, 146, 200
GluI GCNGC 3 cut(s) 28, 146, 200
HaeIII GGCC 1 cut(s) 74
Hin1II CATG 2 cut(s) 207, 218
HinfI GANTC 2 cut(s) 102, 211
HphI GGTGA 1 cut(s) 212
Hpy188III TCNNGA 1 cut(s) 133
HpyCH4V TGCA 3 cut(s) 145, 199, 230
HpyF3I CTNAG 1 cut(s) 64
Hsp92II CATG 2 cut(s) 207, 218
LpnPI CCDG 1 cut(s) 240
Lsp1109I GCAGC 3 cut(s) 14, 157, 211
LweI GCATC 2 cut(s) 157, 174
MaeIII GTNAC 1 cut(s) 110
MlsI TGGCCA 1 cut(s) 74
MluCI AATT 2 cut(s) 78, 244
MluNI TGGCCA 1 cut(s) 74
MmeI TCCRAC 1 cut(s) 171
MnlI CCTC 3 cut(s) 129, 162, 171
Mox20I TGGCCA 1 cut(s) 74
MscI TGGCCA 1 cut(s) 74
Msp20I TGGCCA 1 cut(s) 74
Mva1269I GAATGC 1 cut(s) 84
NcoI CCATGG 1 cut(s) 203
NlaIII CATG 2 cut(s) 207, 218
PctI GAATGC 1 cut(s) 84
PfeI GAWTC 2 cut(s) 102, 211
PflMI CCANNNNNTGG 1 cut(s) 185
PkrI GCNGC 3 cut(s) 29, 147, 201
SatI GCNGC 3 cut(s) 28, 146, 200
SetI ASST 1 cut(s) 55
SfaNI GCATC 2 cut(s) 157, 174
SgeI CNNG 9 cut(s) 51, 82, 109, 145, 174, 181, 216, 227, 239
Sse9I AATT 2 cut(s) 78, 244
StyI CCWWGG 2 cut(s) 69, 203
TaqI TCGA 1 cut(s) 168
TasI AATT 2 cut(s) 78, 244
TfiI GAWTC 2 cut(s) 102, 211
TseI GCWGC 3 cut(s) 27, 145, 199
TspDTI ATGAA 1 cut(s) 203
Van91I CCANNNNNTGG 1 cut(s) 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.