Prupe.3G082800_v2.0.a1

Protein PHLOEM PROTEIN 2-LIKE A1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
N/A
Physical Location & Seq
Forward (+)
6142186 .. 6142480
295 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G082800.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 195 bp
ATGTCAGAGCTGCCATCAGGAGTTGTTTATGAGATTGCATACATGGCCAAAGACCAATGGATAGAGCTTGTTGGTAGCCGTTTCGAGGCCAAGGAAGGAGAGGCTGGAGAAGTTTGCTTTGATCTTTATGACCATGGTGGACACTGGAAAAGTGGGCTAATCGTCAAAGGTATCATTATCAGGCCAAAACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PP2

Protein Analysis

65

Amino Acids

7.19

Weight (kDa)

5.47

Isoelectric Point (pI)

45.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 45
AfiI CCNNNNNNNGG 1 cut(s) 85
AluBI AGCT 2 cut(s) 10, 67
AluI AGCT 2 cut(s) 10, 67
AoxI GGCC 3 cut(s) 45, 87, 182
ApeKI GCWGC 1 cut(s) 10
BalI TGGCCA 1 cut(s) 47
BccI CCATC 1 cut(s) 22
BceAI ACGGC 1 cut(s) 63
BisI GCNGC 1 cut(s) 11
BlsI GCNGC 1 cut(s) 12
BpmI CTGGAG 1 cut(s) 126
BsaJI CCNNGG 2 cut(s) 90, 133
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse1I ACTGG 1 cut(s) 149
BseDI CCNNGG 2 cut(s) 90, 133
BseLI CCNNNNNNNGG 1 cut(s) 85
BseNI ACTGG 1 cut(s) 149
BshFI GGCC 3 cut(s) 47, 89, 184
BslI CCNNNNNNNGG 1 cut(s) 85
BsnI GGCC 3 cut(s) 47, 89, 184
Bsp143I GATC 1 cut(s) 121
Bsp19I CCATGG 1 cut(s) 133
BspANI GGCC 3 cut(s) 47, 89, 184
BsrI ACTGG 1 cut(s) 149
BssECI CCNNGG 2 cut(s) 90, 133
BssMI GATC 1 cut(s) 121
BssT1I CCWWGG 2 cut(s) 90, 133
BstDSI CCRYGG 1 cut(s) 133
BstKTI GATC 1 cut(s) 124
BstMBI GATC 1 cut(s) 121
BstMWI GCNNNNNNNGC 1 cut(s) 44
BsuRI GGCC 3 cut(s) 47, 89, 184
BtgI CCRYGG 1 cut(s) 133
BtsIMutI CAGTG 1 cut(s) 142
CviAII CATG 2 cut(s) 43, 134
CviJI RGCY 8 cut(s) 10, 47, 67, 78, 89, 104, 157, 184
CviKI_1 RGCY 8 cut(s) 10, 47, 67, 78, 89, 104, 157, 184
DpnI GATC 1 cut(s) 123
DpnII GATC 1 cut(s) 121
EaeI YGGCCR 1 cut(s) 45
Eco130I CCWWGG 2 cut(s) 90, 133
EcoT14I CCWWGG 2 cut(s) 90, 133
ErhI CCWWGG 2 cut(s) 90, 133
FaeI CATG 2 cut(s) 46, 137
FaiI YATR 5 cut(s) 30, 40, 44, 129, 135
FatI CATG 2 cut(s) 42, 133
Fnu4HI GCNGC 1 cut(s) 11
Fsp4HI GCNGC 1 cut(s) 11
GluI GCNGC 1 cut(s) 11
GsuI CTGGAG 1 cut(s) 126
HaeIII GGCC 3 cut(s) 47, 89, 184
Hin1II CATG 2 cut(s) 46, 137
Hpy166II GTNNAC 1 cut(s) 140
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 18
Hpy8I GTNNAC 1 cut(s) 140
HpyAV CCTTC 1 cut(s) 89
HpyCH4V TGCA 1 cut(s) 38
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
Hsp92II CATG 2 cut(s) 46, 137
Kzo9I GATC 1 cut(s) 121
LpnPI CCDG 4 cut(s) 3, 90, 130, 166
MalI GATC 1 cut(s) 123
MboI GATC 1 cut(s) 121
MlsI TGGCCA 1 cut(s) 47
MluNI TGGCCA 1 cut(s) 47
MnlI CCTC 2 cut(s) 79, 94
Mox20I TGGCCA 1 cut(s) 47
MscI TGGCCA 1 cut(s) 47
Msp20I TGGCCA 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 44
NcoI CCATGG 1 cut(s) 133
NdeII GATC 1 cut(s) 121
NlaIII CATG 2 cut(s) 46, 137
PkrI GCNGC 1 cut(s) 12
SatI GCNGC 1 cut(s) 11
Sau3AI GATC 1 cut(s) 121
SetI ASST 3 cut(s) 12, 69, 172
SgeI CNNG 8 cut(s) 30, 55, 80, 97, 103, 117, 146, 157
StyI CCWWGG 2 cut(s) 90, 133
TaqI TCGA 1 cut(s) 84
TscAI CASTG 1 cut(s) 149
TseI GCWGC 1 cut(s) 10
TspRI CASTG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.