Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp03

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

9419663 .. 9422362

Gene Structure 2700 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.3G112900.1_v2.0.a1.CDS.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 288 bp

ATGACCAAATCGAAGGAAGGTGAAGACGACATTGACAAAGTTCTTAGAATTCCCATCATGAAATTTTCATATGTTGACTTGCAAGTTGCAACAGAGGATTTCAAGGAAGAACTTGGAAGTGGAGGGTTCGGTTCTGTGATCAATGGAGTTATGGCAGATAGCACAATGATTGCAGTGAAGCAGTTGGATAACAGGGGCCAGGGGATGACGGCGTTCCTAGTTGAAATTGATACAATTAGGAGACTTCACCATTTTAACCTCGTAAGGTTGATTAGATTTTGTGCATAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004672 GO:0004674 GO:0005488 GO:0005515 GO:0005516 GO:0005575 GO:0005623 GO:0005886 GO:0006464 GO:0006468 GO:0006793 GO:0006796 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0016020 GO:0016301 GO:0016310 GO:0016740 GO:0016772 GO:0016773 GO:0019538 GO:0019899 GO:0031625 GO:0036211 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044389 GO:0044464 GO:0046777 GO:0071704 GO:0071944 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

B_lectin Pkinase S_locus_glycop

Protein Analysis

96

Amino Acids

10.68

Weight (kDa)

5.6

Isoelectric Point (pI)

25.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	2 cut(s)	48, 62
AgsI	TTSAA	2 cut(s)	103, 224
AjnI	CCWGG	1 cut(s)	198
Alw26I	GTCTC	1 cut(s)	235
AoxI	GGCC	1 cut(s)	196
ApoI	RAATTY	2 cut(s)	48, 62
AspS9I	GGNCC	1 cut(s)	196
AsuHPI	GGTGA	2 cut(s)	32, 239
BbsI	GAAGAC	1 cut(s)	30
BccI	CCATC	1 cut(s)	62
BceAI	ACGGC	1 cut(s)	225
BciT130I	CCWGG	1 cut(s)	200
BclI	TGATCA	1 cut(s)	138
BcoDI	GTCTC	1 cut(s)	235
BfaI	CTAG	1 cut(s)	218
Bme1390I	CCNGG	1 cut(s)	200
BmgT120I	GGNCC	1 cut(s)	196
BmiI	GGNNCC	1 cut(s)	197
BmrFI	CCNGG	1 cut(s)	200
BpiI	GAAGAC	1 cut(s)	30
BsaJI	CCNNGG	1 cut(s)	199
BseBI	CCWGG	1 cut(s)	200
BseDI	CCNNGG	1 cut(s)	199
BseGI	GGATG	1 cut(s)	210
BshFI	GGCC	1 cut(s)	198
BsmAI	GTCTC	1 cut(s)	235
BsnI	GGCC	1 cut(s)	198
Bsp143I	GATC	1 cut(s)	138
BspANI	GGCC	1 cut(s)	198
BspHI	TCATGA	1 cut(s)	57
BspLI	GGNNCC	1 cut(s)	197
BssECI	CCNNGG	1 cut(s)	199
BssMI	GATC	1 cut(s)	138
Bst2UI	CCWGG	1 cut(s)	200
BstDEI	CTNAG	1 cut(s)	44
BstF5I	GGATG	1 cut(s)	210
BstKTI	GATC	1 cut(s)	141
BstMAI	GTCTC	1 cut(s)	235
BstMBI	GATC	1 cut(s)	138
BstNI	CCWGG	1 cut(s)	200
BstSCI	CCNGG	1 cut(s)	198
BstV2I	GAAGAC	1 cut(s)	30
BsuRI	GGCC	1 cut(s)	198
BtsCI	GGATG	1 cut(s)	210
BtsI	GCAGTG	1 cut(s)	180
BtsIMutI	CAGTG	1 cut(s)	180
CciI	TCATGA	1 cut(s)	57
Cfr13I	GGNCC	1 cut(s)	196
CviAII	CATG	1 cut(s)	58
CviJI	RGCY	1 cut(s)	198
CviKI_1	RGCY	1 cut(s)	198
DdeI	CTNAG	1 cut(s)	44
DpnI	GATC	1 cut(s)	140
DpnII	GATC	1 cut(s)	138
EcoRI	GAATTC	1 cut(s)	48
EcoRII	CCWGG	1 cut(s)	198
FaeI	CATG	1 cut(s)	61
FaiI	YATR	5 cut(s)	59, 70, 72, 152, 286
FatI	CATG	1 cut(s)	57
FauNDI	CATATG	1 cut(s)	70
FbaI	TGATCA	1 cut(s)	138
FokI	GGATG	1 cut(s)	217
FspBI	CTAG	1 cut(s)	218
HaeIII	GGCC	1 cut(s)	198
Hin1II	CATG	1 cut(s)	61
HincII	GTYRAC	1 cut(s)	76
HindII	GTYRAC	1 cut(s)	76
HphI	GGTGA	2 cut(s)	32, 239
Hpy166II	GTNNAC	1 cut(s)	76
Hpy188III	TCNNGA	1 cut(s)	58
Hpy8I	GTNNAC	1 cut(s)	76
HpyAV	CCTTC	2 cut(s)	7, 11
HpyCH4V	TGCA	4 cut(s)	82, 89, 173, 284
HpyF3I	CTNAG	1 cut(s)	44
Hsp92II	CATG	1 cut(s)	61
Ksp22I	TGATCA	1 cut(s)	138
Kzo9I	GATC	1 cut(s)	138
LpnPI	CCDG	3 cut(s)	178, 185, 212
MaeI	CTAG	1 cut(s)	218
MalI	GATC	1 cut(s)	140
MboI	GATC	1 cut(s)	138
MboII	GAAGA	2 cut(s)	35, 119
MluCI	AATT	4 cut(s)	48, 62, 225, 234
MmeI	TCCRAC	1 cut(s)	165
MnlI	CCTC	3 cut(s)	88, 116, 269
MseI	TTAA	1 cut(s)	255
MspR9I	CCNGG	1 cut(s)	200
MvaI	CCWGG	1 cut(s)	200
NdeI	CATATG	1 cut(s)	70
NdeII	GATC	1 cut(s)	138
NlaIII	CATG	1 cut(s)	61
NlaIV	GGNNCC	1 cut(s)	197
PagI	TCATGA	1 cut(s)	57
Psp6I	CCWGG	1 cut(s)	198
PspGI	CCWGG	1 cut(s)	198
PspN4I	GGNNCC	1 cut(s)	197
PspPI	GGNCC	1 cut(s)	196
SaqAI	TTAA	1 cut(s)	255
Sau3AI	GATC	1 cut(s)	138
Sau96I	GGNCC	1 cut(s)	196
ScrFI	CCNGG	1 cut(s)	200
SetI	ASST	3 cut(s)	22, 261, 269
Sse9I	AATT	4 cut(s)	48, 62, 225, 234
SspMI	CTAG	1 cut(s)	218
StyD4I	CCNGG	1 cut(s)	198
TaqI	TCGA	1 cut(s)	11
TasI	AATT	4 cut(s)	48, 62, 225, 234
Tru1I	TTAA	1 cut(s)	255
Tru9I	TTAA	1 cut(s)	255
TscAI	CASTG	1 cut(s)	180
TspDTI	ATGAA	2 cut(s)	57, 74
TspRI	CASTG	1 cut(s)	180
XapI	RAATTY	2 cut(s)	48, 62
XspI	CTAG	1 cut(s)	218

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.