Prupe.3G237200_v2.0.a1

Plays a central role in 2-thiolation of mcm(5)S(2)U at tRNA wobble positions of tRNA(Lys), tRNA(Glu) and tRNA(Gln). Directly binds tRNAs and probably acts by catalyzing adenylation of tRNAs, an intermediate required for 2-thiolation. It is unclear whether it acts as a sulfurtransferase that transfers sulfur from thiocarboxylated URM1 onto the uridine of tRNAs at wobble position

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
N/A
Physical Location & Seq
Forward (+)
23225322 .. 23225974
653 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G237200.1_v2.0.a1.CDS.2

Sequence Viewer

Length: 399 bp
ATGAGTGCATTGCCCTCGGAGCCTCTGATGGGAAAGATTCCACTGTCCGTGTTATCGGAATTGAATAGGCGCCACAATTACGGCCTGGATTTGTTCCTGTTGTCAGTGGATGAGGGCATTACTGGCTACAGGGATGATTCTCTTGAGACCGTCAAAAGAAATGAAATCCAGTATGGTTTGCCGCCAAAAATAGTCTCGTACAAGGATTTGTTTGGGTGGACCATGGATGAAATAGTTAAGATGATTGGTCTCAAGAATAATTGCACCTTCTGTGGTGTTTCGTCTTCAGAAATCTTGTATGCATGTATTTTAGACATAACTTCGGCATTCATATGTTTTGACAACGTCAAAGCTGTGTGGTTGGTTACTCCACATAAACTTATGCTACTTATAATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04122 map04122
Pfam Domains
Protein Families
ATP_bind_3 zn-ribbon_14

Protein Analysis

133

Amino Acids

14.86

Weight (kDa)

5.28

Isoelectric Point (pI)

49.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 392
AccB1I GGYRCC 1 cut(s) 69
AciI CCGC 1 cut(s) 182
AcuI CTGAAG 1 cut(s) 270
AcyI GRCGYC 1 cut(s) 70
AfaI GTAC 1 cut(s) 200
AfiI CCNNNNNNNGG 1 cut(s) 29
AgsI TTSAA 1 cut(s) 64
AjnI CCWGG 1 cut(s) 84
AluBI AGCT 1 cut(s) 353
AluI AGCT 1 cut(s) 353
Alw26I GTCTC 3 cut(s) 140, 199, 254
AoxI GGCC 1 cut(s) 82
AspLEI GCGC 1 cut(s) 72
AspS9I GGNCC 1 cut(s) 219
AvaII GGWCC 1 cut(s) 219
BanI GGYRCC 1 cut(s) 69
BbsI GAAGAC 1 cut(s) 276
BccI CCATC 1 cut(s) 22
BceAI ACGGC 1 cut(s) 97
BcgI CGANNNNNNTGC 1 cut(s) 31
BciT130I CCWGG 1 cut(s) 86
BcoDI GTCTC 3 cut(s) 140, 199, 254
BfmI CTRYAG 1 cut(s) 127
BfoI RGCGCY 1 cut(s) 73
BisI GCNGC 1 cut(s) 182
BlsI GCNGC 1 cut(s) 183
Bme1390I CCNGG 1 cut(s) 86
Bme18I GGWCC 1 cut(s) 219
BmgT120I GGNCC 1 cut(s) 219
BmiI GGNNCC 2 cut(s) 21, 71
BmrFI CCNGG 1 cut(s) 86
BpiI GAAGAC 1 cut(s) 276
BpuEI CTTGAG 2 cut(s) 164, 236
BsaHI GRCGYC 1 cut(s) 70
BsaI GGTCTC 2 cut(s) 140, 254
BsaJI CCNNGG 2 cut(s) 15, 222
Bsc4I CCNNNNNNNGG 1 cut(s) 29
Bse1I ACTGG 2 cut(s) 127, 169
Bse3DI GCAATG 1 cut(s) 8
BseBI CCWGG 1 cut(s) 86
BseDI CCNNGG 2 cut(s) 15, 222
BseGI GGATG 3 cut(s) 115, 139, 232
BseLI CCNNNNNNNGG 1 cut(s) 29
BseMI GCAATG 1 cut(s) 8
BseNI ACTGG 2 cut(s) 127, 169
BshFI GGCC 1 cut(s) 84
BshNI GGYRCC 1 cut(s) 69
BslI CCNNNNNNNGG 1 cut(s) 29
BsmAI GTCTC 3 cut(s) 140, 199, 254
BsmI GAATGC 1 cut(s) 326
BsnI GGCC 1 cut(s) 84
Bso31I GGTCTC 2 cut(s) 140, 254
Bsp19I CCATGG 1 cut(s) 222
BspACI CCGC 1 cut(s) 182
BspANI GGCC 1 cut(s) 84
BspLI GGNNCC 2 cut(s) 21, 71
BspT107I GGYRCC 1 cut(s) 69
BspTNI GGTCTC 2 cut(s) 140, 254
BsrDI GCAATG 1 cut(s) 8
BsrI ACTGG 2 cut(s) 127, 169
BssECI CCNNGG 2 cut(s) 15, 222
BssNI GRCGYC 1 cut(s) 70
BssT1I CCWWGG 1 cut(s) 222
Bst2UI CCWGG 1 cut(s) 86
Bst4CI ACNGT 2 cut(s) 45, 151
BstACI GRCGYC 1 cut(s) 70
BstDSI CCRYGG 1 cut(s) 222
BstF5I GGATG 3 cut(s) 115, 139, 232
BstH2I RGCGCY 1 cut(s) 73
BstHHI GCGC 1 cut(s) 72
BstMAI GTCTC 3 cut(s) 140, 199, 254
BstMWI GCNNNNNNNGC 2 cut(s) 19, 123
BstNI CCWGG 1 cut(s) 86
BstNSI RCATGY 1 cut(s) 306
BstSCI CCNGG 1 cut(s) 84
BstSFI CTRYAG 1 cut(s) 127
BstV2I GAAGAC 1 cut(s) 276
BsuRI GGCC 1 cut(s) 84
BtgI CCRYGG 1 cut(s) 222
BtsCI GGATG 3 cut(s) 115, 139, 232
BtsIMutI CAGTG 2 cut(s) 41, 111
CfoI GCGC 1 cut(s) 72
Cfr13I GGNCC 1 cut(s) 219
Csp6I GTAC 1 cut(s) 199
CviAII CATG 2 cut(s) 223, 303
CviJI RGCY 4 cut(s) 22, 84, 126, 353
CviKI_1 RGCY 4 cut(s) 22, 84, 126, 353
CviQI GTAC 1 cut(s) 199
DinI GGCGCC 1 cut(s) 71
Eco130I CCWWGG 1 cut(s) 222
Eco31I GGTCTC 2 cut(s) 140, 254
Eco47I GGWCC 1 cut(s) 219
Eco57I CTGAAG 1 cut(s) 270
EcoRII CCWGG 1 cut(s) 84
EcoT14I CCWWGG 1 cut(s) 222
EcoT22I ATGCAT 1 cut(s) 304
EgeI GGCGCC 1 cut(s) 71
EheI GGCGCC 1 cut(s) 71
ErhI CCWWGG 1 cut(s) 222
FaeI CATG 2 cut(s) 226, 306
FatI CATG 2 cut(s) 222, 302
FauNDI CATATG 1 cut(s) 332
Fnu4HI GCNGC 1 cut(s) 182
FokI GGATG 3 cut(s) 122, 146, 239
Fsp4HI GCNGC 1 cut(s) 182
GlaI GCGC 1 cut(s) 71
GluI GCNGC 1 cut(s) 182
HaeII RGCGCY 1 cut(s) 73
HaeIII GGCC 1 cut(s) 84
HhaI GCGC 1 cut(s) 72
Hin1I GRCGYC 1 cut(s) 70
Hin1II CATG 2 cut(s) 226, 306
Hin6I GCGC 1 cut(s) 70
HinP1I GCGC 1 cut(s) 70
HinfI GANTC 2 cut(s) 37, 137
Hpy166II GTNNAC 1 cut(s) 219
Hpy188I TCNGA 4 cut(s) 19, 27, 58, 289
Hpy188III TCNNGA 2 cut(s) 143, 253
Hpy8I GTNNAC 1 cut(s) 219
HpyAV CCTTC 1 cut(s) 277
HpyCH4III ACNGT 2 cut(s) 45, 151
HpyCH4IV ACGT 1 cut(s) 345
HpyCH4V TGCA 3 cut(s) 8, 264, 302
HpyF10VI GCNNNNNNNGC 2 cut(s) 19, 123
HpySE526I ACGT 1 cut(s) 345
Hsp92I GRCGYC 1 cut(s) 70
Hsp92II CATG 2 cut(s) 226, 306
HspAI GCGC 1 cut(s) 70
KasI GGCGCC 1 cut(s) 69
LmnI GCTCC 1 cut(s) 19
LpnPI CCDG 6 cut(s) 71, 98, 108, 110, 115, 182
MaeII ACGT 1 cut(s) 345
MaeIII GTNAC 1 cut(s) 364
MboII GAAGA 1 cut(s) 276
MluCI AATT 4 cut(s) 59, 76, 259, 393
Mly113I GGCGCC 1 cut(s) 70
MnlI CCTC 3 cut(s) 25, 33, 106
Mph1103I ATGCAT 1 cut(s) 304
MseI TTAA 1 cut(s) 237
MslI CAYNNNNRTG 1 cut(s) 331
MspR9I CCNGG 1 cut(s) 86
Mva1269I GAATGC 1 cut(s) 326
MvaI CCWGG 1 cut(s) 86
MwoI GCNNNNNNNGC 2 cut(s) 19, 123
NarI GGCGCC 1 cut(s) 70
NcoI CCATGG 1 cut(s) 222
NdeI CATATG 1 cut(s) 332
NlaIII CATG 2 cut(s) 226, 306
NlaIV GGNNCC 2 cut(s) 21, 71
NsiI ATGCAT 1 cut(s) 304
NspI RCATGY 1 cut(s) 306
PctI GAATGC 1 cut(s) 326
PfeI GAWTC 2 cut(s) 37, 137
PflFI GACNNNGTC 1 cut(s) 344
PkrI GCNGC 1 cut(s) 183
PluTI GGCGCC 1 cut(s) 73
PsiI TTATAA 1 cut(s) 392
Psp6I CCWGG 1 cut(s) 84
PspGI CCWGG 1 cut(s) 84
PspN4I GGNNCC 2 cut(s) 21, 71
PspPI GGNCC 1 cut(s) 219
PsyI GACNNNGTC 1 cut(s) 344
RsaI GTAC 1 cut(s) 200
RsaNI GTAC 1 cut(s) 199
RseI CAYNNNNRTG 1 cut(s) 331
SaqAI TTAA 1 cut(s) 237
SatI GCNGC 1 cut(s) 182
Sau96I GGNCC 1 cut(s) 219
ScrFI CCNGG 1 cut(s) 86
SetI ASST 3 cut(s) 269, 348, 355
SfcI CTRYAG 1 cut(s) 127
SfoI GGCGCC 1 cut(s) 71
SinI GGWCC 1 cut(s) 219
SmiMI CAYNNNNRTG 1 cut(s) 331
SmlI CTYRAG 2 cut(s) 143, 251
SmoI CTYRAG 2 cut(s) 143, 251
Sse9I AATT 4 cut(s) 59, 76, 259, 393
SsiI CCGC 1 cut(s) 182
SspDI GGCGCC 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 84
StyI CCWWGG 1 cut(s) 222
TaaI ACNGT 2 cut(s) 45, 151
TaiI ACGT 1 cut(s) 348
TasI AATT 4 cut(s) 59, 76, 259, 393
TauI GCSGC 1 cut(s) 184
TfiI GAWTC 2 cut(s) 37, 137
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TscAI CASTG 2 cut(s) 48, 111
TspDTI ATGAA 3 cut(s) 177, 243, 319
TspGWI ACGGA 1 cut(s) 37
TspRI CASTG 2 cut(s) 48, 111
Tth111I GACNNNGTC 1 cut(s) 344
VpaK11BI GGWCC 1 cut(s) 219
XceI RCATGY 1 cut(s) 306
Zsp2I ATGCAT 1 cut(s) 304
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.