Prupe.3G292900_v2.0.a1

Fatty-acid-binding protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
N/A
Physical Location & Seq
Reverse (-)
26200061 .. 26201131
1071 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G292900.1_v2.0.a1.CDS.4

Sequence Viewer

Length: 648 bp
CTGCCAAGGCTGAGAACCGGACAGGAGGAGGAGGCAAAAAAGGAGGAGGTGGCAGTTGAGATTGAACCCAAGACTGGGGTCTCCTTTCCATTTAAACTGGATGATGGGAAACAGTTGGGTTGTGTTGGTCTGAGGAAGAAATCCATGCTTGGCATAGGCATCAAGATTTATGGATTCGGGATTTATGCAGACAATGAGAAGCTGAGAGAACTTCTCAAGTTGAAAATTGGGAAGGCCCCAGCAAAACCCACGAAGGATATGTATCAGTTGGTGATTGACAGTGATGCCGAGATGATGGTCAGGTTAGTGATCGTATTTTCCAGCCTCACCATGAACATGGTAAGAAAGAATTTTGATGAAGGTCTTGGAGCATCAATCAAGAAACTTACTGGTGGCAAGAAGAACGAGGCACTCGCAAATAAGGTAATGGGACAAGCATCAGATGACATTAAGCTAACCTCTGGTTCTGTGATTGAGATTTCTCGGCTTCCGGGAAACATTCTCCAAACCAAAGTGATTGGTGAGGTGGTCAGCAAGGTTGAGAGTGAACTCTTGTGCAGGGCCTATGTGAACATGTATCTGGGAGACGATCCCTTGGACAAGGATACCCAGGAGAAGTTCGGAATGTCCCTGCCTTCACTCTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Chalcone_3

Protein Analysis

216

Amino Acids

23.69

Weight (kDa)

8.69

Isoelectric Point (pI)

34.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 584
AcsI RAATTY 1 cut(s) 349
AfiI CCNNNNNNNGG 2 cut(s) 74, 75
AflIII ACRYGT 1 cut(s) 573
AgsI TTSAA 2 cut(s) 65, 223
AjnI CCWGG 1 cut(s) 609
AluBI AGCT 2 cut(s) 202, 454
AluI AGCT 2 cut(s) 202, 454
Alw26I GTCTC 2 cut(s) 85, 579
AlwI GGATC 1 cut(s) 584
AoxI GGCC 2 cut(s) 234, 561
ApoI RAATTY 1 cut(s) 349
AspS9I GGNCC 2 cut(s) 235, 561
AsuC2I CCSGG 1 cut(s) 492
AsuHPI GGTGA 3 cut(s) 283, 319, 533
BccI CCATC 2 cut(s) 98, 289
BciT130I CCWGG 1 cut(s) 611
BciVI GTATCC 1 cut(s) 598
BcnI CCSGG 1 cut(s) 492
BcoDI GTCTC 2 cut(s) 85, 579
BfuI GTATCC 1 cut(s) 598
Bme1390I CCNGG 2 cut(s) 492, 611
BmgT120I GGNCC 2 cut(s) 235, 561
BmiI GGNNCC 1 cut(s) 237
BmrFI CCNGG 2 cut(s) 492, 611
BmrI ACTGGG 1 cut(s) 84
BmsI GCATC 4 cut(s) 168, 274, 380, 446
BmuI ACTGGG 1 cut(s) 84
BoxI GACNNNNGTC 1 cut(s) 77
BplI GAGNNNNNCTC 2 cut(s) 198, 230
BpuEI CTTGAG 1 cut(s) 200
BpuMI CCSGG 1 cut(s) 492
BsaBI GATNNNNATC 1 cut(s) 261
BsaI GGTCTC 1 cut(s) 85
BsaJI CCNNGG 3 cut(s) 5, 594, 609
BsaWI WCCGGW 1 cut(s) 17
Bsc4I CCNNNNNNNGG 2 cut(s) 74, 75
Bse1I ACTGG 3 cut(s) 79, 102, 394
Bse8I GATNNNNATC 1 cut(s) 261
BseBI CCWGG 1 cut(s) 611
BseDI CCNNGG 3 cut(s) 5, 594, 609
BseGI GGATG 1 cut(s) 106
BseJI GATNNNNATC 1 cut(s) 261
BseLI CCNNNNNNNGG 2 cut(s) 74, 75
BseMII CTCAG 2 cut(s) 122, 194
BseNI ACTGG 3 cut(s) 79, 102, 394
BseRI GAGGAG 3 cut(s) 41, 44, 59
BseYI CCCAGC 1 cut(s) 238
BsgI GTGCAG 1 cut(s) 577
BshFI GGCC 2 cut(s) 236, 563
BsiSI CCGG 2 cut(s) 18, 491
BslFI GGGAC 2 cut(s) 444, 613
BslI CCNNNNNNNGG 2 cut(s) 74, 75
BsmAI GTCTC 2 cut(s) 85, 579
BsmBI CGTCTC 1 cut(s) 579
BsmFI GGGAC 2 cut(s) 444, 613
BsnI GGCC 2 cut(s) 236, 563
Bso31I GGTCTC 1 cut(s) 85
Bsp143I GATC 2 cut(s) 309, 589
BspANI GGCC 2 cut(s) 236, 563
BspCNI CTCAG 2 cut(s) 123, 195
BspLI GGNNCC 1 cut(s) 237
BspPI GGATC 1 cut(s) 584
BspTNI GGTCTC 1 cut(s) 85
BsrI ACTGG 3 cut(s) 79, 102, 394
BssECI CCNNGG 3 cut(s) 5, 594, 609
BssMI GATC 2 cut(s) 309, 589
BssT1I CCWWGG 2 cut(s) 5, 594
Bst2UI CCWGG 1 cut(s) 611
Bst4CI ACNGT 2 cut(s) 114, 281
BstDEI CTNAG 3 cut(s) 11, 131, 203
BstF5I GGATG 1 cut(s) 106
BstKTI GATC 2 cut(s) 312, 592
BstMAI GTCTC 2 cut(s) 85, 579
BstMBI GATC 2 cut(s) 309, 589
BstNI CCWGG 1 cut(s) 611
BstNSI RCATGY 1 cut(s) 577
BstPAI GACNNNNGTC 1 cut(s) 77
BstSCI CCNGG 2 cut(s) 490, 609
BstXI CCANNNNNNTGG 1 cut(s) 337
BsuI GTATCC 1 cut(s) 598
BsuRI GGCC 2 cut(s) 236, 563
BtsCI GGATG 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 286
Cfr13I GGNCC 2 cut(s) 235, 561
CviAII CATG 4 cut(s) 145, 331, 337, 574
CviJI RGCY 7 cut(s) 10, 202, 236, 324, 454, 487, 563
CviKI_1 RGCY 7 cut(s) 10, 202, 236, 324, 454, 487, 563
DdeI CTNAG 3 cut(s) 11, 131, 203
DpnI GATC 2 cut(s) 311, 591
DpnII GATC 2 cut(s) 309, 589
DraI TTTAAA 1 cut(s) 94
Eco130I CCWWGG 2 cut(s) 5, 594
Eco31I GGTCTC 1 cut(s) 85
EcoO109I RGGNCCY 2 cut(s) 235, 561
EcoRII CCWGG 1 cut(s) 609
EcoT14I CCWWGG 2 cut(s) 5, 594
ErhI CCWWGG 2 cut(s) 5, 594
Esp3I CGTCTC 1 cut(s) 579
FaeI CATG 4 cut(s) 148, 334, 340, 577
FaiI YATR 9 cut(s) 146, 155, 171, 186, 260, 332, 338, 567, 575
FaqI GGGAC 2 cut(s) 444, 613
FatI CATG 4 cut(s) 144, 330, 336, 573
FokI GGATG 1 cut(s) 113
GsaI CCCAGC 1 cut(s) 242
HaeIII GGCC 2 cut(s) 236, 563
HapII CCGG 2 cut(s) 18, 491
Hin1II CATG 4 cut(s) 148, 334, 340, 577
HinfI GANTC 1 cut(s) 174
HpaII CCGG 2 cut(s) 18, 491
HphI GGTGA 3 cut(s) 283, 319, 533
Hpy166II GTNNAC 2 cut(s) 548, 571
Hpy188I TCNGA 3 cut(s) 132, 442, 623
Hpy188III TCNNGA 3 cut(s) 163, 178, 379
Hpy8I GTNNAC 2 cut(s) 548, 571
HpyAV CCTTC 4 cut(s) 226, 247, 353, 645
HpyCH4III ACNGT 2 cut(s) 114, 281
HpyCH4V TGCA 2 cut(s) 188, 558
HpyF3I CTNAG 3 cut(s) 11, 131, 203
Hsp92II CATG 4 cut(s) 148, 334, 340, 577
Kzo9I GATC 2 cut(s) 309, 589
LmnI GCTCC 1 cut(s) 368
LweI GCATC 4 cut(s) 168, 274, 380, 446
MalI GATC 2 cut(s) 311, 591
MboI GATC 2 cut(s) 309, 589
MboII GAAGA 3 cut(s) 148, 412, 634
MluCI AATT 2 cut(s) 225, 349
MseI TTAA 2 cut(s) 93, 450
MslI CAYNNNNRTG 1 cut(s) 335
MspI CCGG 2 cut(s) 18, 491
MspR9I CCNGG 2 cut(s) 492, 611
MvaI CCWGG 1 cut(s) 611
NciI CCSGG 1 cut(s) 492
NdeII GATC 2 cut(s) 309, 589
NlaIII CATG 4 cut(s) 148, 334, 340, 577
NlaIV GGNNCC 1 cut(s) 237
NmeAIII GCCGAG 2 cut(s) 313, 463
NspI RCATGY 1 cut(s) 577
PciI ACATGT 1 cut(s) 573
PfeI GAWTC 1 cut(s) 174
PfoI TCCNGGA 1 cut(s) 490
PscI ACATGT 1 cut(s) 573
PshAI GACNNNNGTC 1 cut(s) 77
Psp6I CCWGG 1 cut(s) 609
PspFI CCCAGC 1 cut(s) 238
PspGI CCWGG 1 cut(s) 609
PspN4I GGNNCC 1 cut(s) 237
PspPI GGNCC 2 cut(s) 235, 561
RseI CAYNNNNRTG 1 cut(s) 335
SaqAI TTAA 2 cut(s) 93, 450
Sau3AI GATC 2 cut(s) 309, 589
Sau96I GGNCC 2 cut(s) 235, 561
ScrFI CCNGG 2 cut(s) 492, 611
SetI ASST 9 cut(s) 51, 204, 305, 364, 426, 456, 461, 528, 540
SfaNI GCATC 4 cut(s) 168, 274, 380, 446
SmiMI CAYNNNNRTG 1 cut(s) 335
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 2 cut(s) 225, 349
StyD4I CCNGG 2 cut(s) 490, 609
StyI CCWWGG 2 cut(s) 5, 594
TaaI ACNGT 2 cut(s) 114, 281
TasI AATT 2 cut(s) 225, 349
TfiI GAWTC 1 cut(s) 174
Tru1I TTAA 2 cut(s) 93, 450
Tru9I TTAA 2 cut(s) 93, 450
TscAI CASTG 1 cut(s) 286
TspDTI ATGAA 2 cut(s) 347, 372
TspRI CASTG 1 cut(s) 286
XapI RAATTY 1 cut(s) 349
XceI RCATGY 1 cut(s) 577
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.