Prupe.3G296900_v2.0.a1

Protein GDAP2 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
N/A
Physical Location & Seq
Forward (+)
26369333 .. 26372217
2885 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G296900.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 141 bp
ATGGATGAAGCACAATGCATCACTGGCTTGCATGCTGCAGCCGGACCTGGTCTTGCAGAAGAATGTGCTGCACTGATGCTGATATTTCTGTACTCAAGAGTGGAAGAAGAAGAAGTGAAGAAGGGTAGTGTTGGTGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CRAL_TRIO_2 Macro

Protein Analysis

47

Amino Acids

4.81

Weight (kDa)

4.42

Isoelectric Point (pI)

42.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 92
AjnI CCWGG 1 cut(s) 46
ApeKI GCWGC 3 cut(s) 35, 38, 68
AspS9I GGNCC 1 cut(s) 44
AvaII GGWCC 1 cut(s) 44
BbvI GCAGC 3 cut(s) 22, 50, 55
BciT130I CCWGG 1 cut(s) 48
BfmI CTRYAG 1 cut(s) 36
BisI GCNGC 3 cut(s) 36, 39, 69
BlsI GCNGC 3 cut(s) 37, 40, 70
Bme1390I CCNGG 1 cut(s) 48
Bme18I GGWCC 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 44
BmrFI CCNGG 1 cut(s) 48
BmsI GCATC 2 cut(s) 27, 66
BpuEI CTTGAG 1 cut(s) 79
Bse1I ACTGG 1 cut(s) 28
BseBI CCWGG 1 cut(s) 48
BseGI GGATG 1 cut(s) 10
BseNI ACTGG 1 cut(s) 28
BseXI GCAGC 3 cut(s) 22, 50, 55
BsgI GTGCAG 1 cut(s) 54
BsiSI CCGG 1 cut(s) 42
BspMAI CTGCAG 1 cut(s) 40
BsrI ACTGG 1 cut(s) 28
Bst2UI CCWGG 1 cut(s) 48
BstC8I GCNNGC 2 cut(s) 29, 33
BstF5I GGATG 1 cut(s) 10
BstMWI GCNNNNNNNGC 1 cut(s) 24
BstNI CCWGG 1 cut(s) 48
BstNSI RCATGY 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 46
BstSFI CTRYAG 1 cut(s) 36
BstV1I GCAGC 3 cut(s) 22, 50, 55
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 2 cut(s) 21, 71
Cac8I GCNNGC 2 cut(s) 29, 33
Cfr13I GGNCC 1 cut(s) 44
CsiI ACCWGGT 1 cut(s) 46
Csp6I GTAC 1 cut(s) 91
CviAII CATG 1 cut(s) 32
CviJI RGCY 2 cut(s) 27, 41
CviKI_1 RGCY 2 cut(s) 27, 41
CviQI GTAC 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 44
EcoRII CCWGG 1 cut(s) 46
EcoT22I ATGCAT 1 cut(s) 20
FaeI CATG 1 cut(s) 35
FaiI YATR 2 cut(s) 33, 139
FatI CATG 1 cut(s) 31
Fnu4HI GCNGC 3 cut(s) 36, 39, 69
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 3 cut(s) 36, 39, 69
FspEI CC 9 cut(s) 9, 27, 33, 55, 60, 86, 107, 108, 117
GluI GCNGC 3 cut(s) 36, 39, 69
HapII CCGG 1 cut(s) 42
Hin1II CATG 1 cut(s) 35
HpaII CCGG 1 cut(s) 42
Hpy188III TCNNGA 1 cut(s) 96
HpyAV CCTTC 1 cut(s) 115
HpyCH4V TGCA 6 cut(s) 18, 31, 38, 56, 71, 137
HpyF10VI GCNNNNNNNGC 1 cut(s) 24
Hsp92II CATG 1 cut(s) 35
LpnPI CCDG 4 cut(s) 9, 33, 55, 60
Lsp1109I GCAGC 3 cut(s) 22, 50, 55
LweI GCATC 2 cut(s) 27, 66
MabI ACCWGGT 1 cut(s) 46
MboII GAAGA 5 cut(s) 71, 116, 119, 122, 130
Mph1103I ATGCAT 1 cut(s) 20
MspI CCGG 1 cut(s) 42
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
MwoI GCNNNNNNNGC 1 cut(s) 24
NlaIII CATG 1 cut(s) 35
NsiI ATGCAT 1 cut(s) 20
NspI RCATGY 1 cut(s) 35
PaeI GCATGC 1 cut(s) 35
PflFI GACNNNGTC 1 cut(s) 48
PkrI GCNGC 3 cut(s) 37, 40, 70
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
PspPI GGNCC 1 cut(s) 44
PstI CTGCAG 1 cut(s) 40
PsyI GACNNNGTC 1 cut(s) 48
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
SatI GCNGC 3 cut(s) 36, 39, 69
Sau96I GGNCC 1 cut(s) 44
ScrFI CCNGG 1 cut(s) 48
SetI ASST 1 cut(s) 49
SexAI ACCWGGT 1 cut(s) 46
SfaNI GCATC 2 cut(s) 27, 66
SfcI CTRYAG 1 cut(s) 36
SgeI CNNG 8 cut(s) 36, 40, 44, 54, 59, 60, 65, 108
SinI GGWCC 1 cut(s) 44
SmlI CTYRAG 1 cut(s) 94
SmoI CTYRAG 1 cut(s) 94
SphI GCATGC 1 cut(s) 35
StyD4I CCNGG 1 cut(s) 46
TatI WGTACW 1 cut(s) 90
TscAI CASTG 2 cut(s) 28, 78
TseI GCWGC 3 cut(s) 35, 38, 68
TspDTI ATGAA 1 cut(s) 21
TspRI CASTG 2 cut(s) 28, 78
Tth111I GACNNNGTC 1 cut(s) 48
VpaK11BI GGWCC 1 cut(s) 44
XceI RCATGY 1 cut(s) 35
Zsp2I ATGCAT 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.