Prupe.4G153900_v2.0.a1

cysteine-type peptidase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
N/A
Physical Location & Seq
Forward (+)
8819844 .. 8820164
321 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G153900.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 321 bp
ATGATCCTACACAATAGGACCCTAGCAACTGAGGATGGCTACCCTTACAAGGCTGTAGATAATGGCATTTGCATGGCTGACTGGAATGCTTCTACCGGTGCTATAACTGTAACTGGATACGAGCAAGTGCCTCAAAACAACGAAAGGGCTCTATTGAGGGCTGTTGCGAACCAGCCAGTTTCAGTTTATATTGATGCAGAAGCAGAAGAATTCAAATATTATTCTGGTGGTTTGTACAAACTTAACTCATGCTGTTACTATGTCGGATATAATACTACTCAGGATGATGGGACTAAGTATTGGCTAGTCAAAAATTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04140 ko04142 ko04210 ko04612 ko04621 ko04924 map04140 map04142 map04210 map04612 map04621 map04924
Pfam Domains
Protein Families
Granulin Inhibitor_I29 Peptidase_C1

Protein Analysis

107

Amino Acids

11.9

Weight (kDa)

4.75

Isoelectric Point (pI)

28.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 209, 313
AfaI GTAC 1 cut(s) 236
AfiI CCNNNNNNNGG 1 cut(s) 49
AgeI ACCGGT 1 cut(s) 95
AgsI TTSAA 1 cut(s) 214
ApoI RAATTY 2 cut(s) 209, 313
AsiGI ACCGGT 1 cut(s) 95
AspS9I GGNCC 1 cut(s) 18
AvaII GGWCC 1 cut(s) 18
BanII GRGCYC 1 cut(s) 151
BccI CCATC 2 cut(s) 29, 281
BciVI GTATCC 1 cut(s) 110
BfaI CTAG 2 cut(s) 23, 305
BfmI CTRYAG 1 cut(s) 54
BfuI GTATCC 1 cut(s) 110
Bme18I GGWCC 1 cut(s) 18
BmgT120I GGNCC 1 cut(s) 18
BmiI GGNNCC 1 cut(s) 20
BmsI GCATC 1 cut(s) 184
BsaWI WCCGGW 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 49
Bse118I RCCGGY 1 cut(s) 95
Bse1I ACTGG 3 cut(s) 86, 118, 176
BseGI GGATG 2 cut(s) 40, 289
BseLI CCNNNNNNNGG 1 cut(s) 49
BseMII CTCAG 2 cut(s) 21, 293
BseNI ACTGG 3 cut(s) 86, 118, 176
BshTI ACCGGT 1 cut(s) 95
BsiSI CCGG 1 cut(s) 96
BslFI GGGAC 1 cut(s) 304
BslI CCNNNNNNNGG 1 cut(s) 49
BsmFI GGGAC 1 cut(s) 304
BsmI GAATGC 1 cut(s) 91
Bsp1286I GDGCHC 1 cut(s) 151
Bsp1407I TGTACA 1 cut(s) 234
Bsp143I GATC 1 cut(s) 3
BspCNI CTCAG 2 cut(s) 22, 292
BspLI GGNNCC 1 cut(s) 20
BsrFI RCCGGY 1 cut(s) 95
BsrGI TGTACA 1 cut(s) 234
BsrI ACTGG 3 cut(s) 86, 118, 176
BssAI RCCGGY 1 cut(s) 95
BssMI GATC 1 cut(s) 3
Bst4CI ACNGT 1 cut(s) 109
BstAUI TGTACA 1 cut(s) 234
BstDEI CTNAG 3 cut(s) 30, 279, 294
BstF5I GGATG 2 cut(s) 40, 289
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstSFI CTRYAG 1 cut(s) 54
BsuI GTATCC 1 cut(s) 110
BtsCI GGATG 2 cut(s) 40, 289
Cfr10I RCCGGY 1 cut(s) 95
Cfr13I GGNCC 1 cut(s) 18
Csp6I GTAC 1 cut(s) 235
CspAI ACCGGT 1 cut(s) 95
CviAII CATG 2 cut(s) 73, 249
CviJI RGCY 7 cut(s) 39, 53, 77, 149, 161, 175, 304
CviKI_1 RGCY 7 cut(s) 39, 53, 77, 149, 161, 175, 304
CviQI GTAC 1 cut(s) 235
DdeI CTNAG 3 cut(s) 30, 279, 294
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco24I GRGCYC 1 cut(s) 151
Eco47I GGWCC 1 cut(s) 18
EcoO109I RGGNCCY 1 cut(s) 18
EcoRI GAATTC 1 cut(s) 209
EcoT38I GRGCYC 1 cut(s) 151
FaeI CATG 2 cut(s) 76, 252
FaiI YATR 6 cut(s) 74, 104, 189, 250, 261, 270
FaqI GGGAC 1 cut(s) 304
FatI CATG 2 cut(s) 72, 248
FokI GGATG 2 cut(s) 47, 296
FriOI GRGCYC 1 cut(s) 151
FspBI CTAG 2 cut(s) 23, 305
HapII CCGG 1 cut(s) 96
Hin1II CATG 2 cut(s) 76, 252
HpaII CCGG 1 cut(s) 96
Hpy188I TCNGA 1 cut(s) 266
Hpy188III TCNNGA 2 cut(s) 281, 318
HpyCH4III ACNGT 1 cut(s) 109
HpyCH4V TGCA 2 cut(s) 72, 197
HpyF3I CTNAG 3 cut(s) 30, 279, 294
Hsp92II CATG 2 cut(s) 76, 252
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 7 cut(s) 67, 99, 109, 185, 189, 210, 266
LweI GCATC 1 cut(s) 184
MaeI CTAG 2 cut(s) 23, 305
MaeIII GTNAC 2 cut(s) 109, 254
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 218
MhlI GDGCHC 1 cut(s) 151
MluCI AATT 2 cut(s) 209, 313
MmeI TCCRAC 1 cut(s) 244
MnlI CCTC 3 cut(s) 25, 141, 150
MseI TTAA 1 cut(s) 243
MslI CAYNNNNRTG 1 cut(s) 71
MspI CCGG 1 cut(s) 96
Mva1269I GAATGC 1 cut(s) 91
NdeII GATC 1 cut(s) 3
NlaIII CATG 2 cut(s) 76, 252
NlaIV GGNNCC 1 cut(s) 20
PctI GAATGC 1 cut(s) 91
PinAI ACCGGT 1 cut(s) 95
PpuMI RGGWCCY 1 cut(s) 18
Psp5II RGGWCCY 1 cut(s) 18
PspN4I GGNNCC 1 cut(s) 20
PspPI GGNCC 1 cut(s) 18
PspPPI RGGWCCY 1 cut(s) 18
RsaI GTAC 1 cut(s) 236
RsaNI GTAC 1 cut(s) 235
RseI CAYNNNNRTG 1 cut(s) 71
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 18
SduI GDGCHC 1 cut(s) 151
SfaNI GCATC 1 cut(s) 184
SfcI CTRYAG 1 cut(s) 54
SinI GGWCC 1 cut(s) 18
SmiMI CAYNNNNRTG 1 cut(s) 71
Sse9I AATT 2 cut(s) 209, 313
SspI AATATT 1 cut(s) 218
SspMI CTAG 2 cut(s) 23, 305
TaaI ACNGT 1 cut(s) 109
TasI AATT 2 cut(s) 209, 313
TatI WGTACW 1 cut(s) 234
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
VpaK11BI GGWCC 1 cut(s) 18
XapI RAATTY 2 cut(s) 209, 313
XspI CTAG 2 cut(s) 23, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.