Prupe.4G184600_v2.0.a1

Mitochondrial ribosomal subunit protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
N/A
Physical Location & Seq
Reverse (-)
10946471 .. 10947993
1523 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G184600.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 555 bp
ATGAAAGGGTGTGAGGCGATTCTTGAGGATATGCTTAGCTGGGATAAGCTCCTGCCAGATGACATGAAAAGGAAGGTTGAAGAGAAGTTCAATGACCTAAGGGACATGTGTGAAAGAGGGGAACTTGAACCTGAAGAAGCTTACAAGTTGCTTAAGGTGTTTGAGGATGAGATTTTCATGCGATGTGTGCAGAAGATGGAAACCGACAGGCCCCCACAATTTGATGAGACTGCTGGACGGGACGAGAAAAGGGAGGTAGATGACCCACCAGGCGAAGGACCAATCCTTAGGTGGCAAACACGGGCAGTCTTTGCTCCTGGTGGTGATGCCTGGCATCCCAAGAATAGAGAAGTGAAAGTGTCTGTTACAGTGAAAGAACTTGGGCTTTCAAGGCATCAATTCCGTCGGCTCAGAGAATTGGCCGGAAAGCGCTACAATCCAGGGGAAGATGAGCGTACAATTACTAGTGAGAGGTGTTGGCGTGACTTGTGGATATTGACTTACTTTCCTTACACACTAAGAATTCCTATTATAATTGTAATTGATTTACTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MRP-S28

Protein Analysis

185

Amino Acids

21.83

Weight (kDa)

5.21

Isoelectric Point (pI)

44.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 533
AcoI YGGCCR 1 cut(s) 420
AcsI RAATTY 1 cut(s) 522
AcuI CTGAAG 1 cut(s) 153
AfaI GTAC 1 cut(s) 457
AfeI AGCGCT 1 cut(s) 431
AfiI CCNNNNNNNGG 1 cut(s) 275
AflII CTTAAG 1 cut(s) 152
AflIII ACRYGT 1 cut(s) 105
AgsI TTSAA 4 cut(s) 80, 91, 128, 390
AhlI ACTAGT 1 cut(s) 464
AjnI CCWGG 4 cut(s) 268, 316, 329, 439
AluBI AGCT 3 cut(s) 39, 49, 140
AluI AGCT 3 cut(s) 39, 49, 140
Alw26I GTCTC 1 cut(s) 221
Aor51HI AGCGCT 1 cut(s) 431
AoxI GGCC 2 cut(s) 209, 420
ApoI RAATTY 1 cut(s) 522
AspLEI GCGC 1 cut(s) 432
AspS9I GGNCC 2 cut(s) 210, 278
AsuHPI GGTGA 1 cut(s) 335
AvaII GGWCC 1 cut(s) 278
AxyI CCTNAGG 2 cut(s) 98, 287
BccI CCATC 1 cut(s) 190
BciT130I CCWGG 4 cut(s) 270, 318, 331, 441
BcoDI GTCTC 1 cut(s) 221
BcuI ACTAGT 1 cut(s) 464
BfaI CTAG 1 cut(s) 465
BfoI RGCGCY 1 cut(s) 433
BfrI CTTAAG 1 cut(s) 152
BlpI GCTNAGC 1 cut(s) 35
Bme1390I CCNGG 4 cut(s) 270, 318, 331, 441
Bme18I GGWCC 1 cut(s) 278
BmgT120I GGNCC 2 cut(s) 210, 278
BmiI GGNNCC 1 cut(s) 212
BmrFI CCNGG 4 cut(s) 270, 318, 331, 441
BmsI GCATC 3 cut(s) 316, 343, 403
Bpu1102I GCTNAGC 1 cut(s) 35
BpuEI CTTGAG 1 cut(s) 44
BsaJI CCNNGG 1 cut(s) 440
Bsc4I CCNNNNNNNGG 1 cut(s) 275
Bse21I CCTNAGG 2 cut(s) 98, 287
BseBI CCWGG 4 cut(s) 270, 318, 331, 441
BseDI CCNNGG 1 cut(s) 440
BseGI GGATG 2 cut(s) 172, 334
BseLI CCNNNNNNNGG 1 cut(s) 275
BseMII CTCAG 1 cut(s) 424
BseYI CCCAGC 1 cut(s) 39
BsgI GTGCAG 1 cut(s) 209
BshFI GGCC 2 cut(s) 211, 422
BsiSI CCGG 1 cut(s) 423
BslFI GGGAC 2 cut(s) 116, 254
BslI CCNNNNNNNGG 1 cut(s) 275
BsmAI GTCTC 1 cut(s) 221
BsmFI GGGAC 2 cut(s) 116, 254
BsnI GGCC 2 cut(s) 211, 422
Bsp1720I GCTNAGC 1 cut(s) 35
BspANI GGCC 2 cut(s) 211, 422
BspCNI CTCAG 1 cut(s) 423
BspLI GGNNCC 1 cut(s) 212
BspTI CTTAAG 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 440
Bst2UI CCWGG 4 cut(s) 270, 318, 331, 441
Bst4CI ACNGT 1 cut(s) 370
Bst6I CTCTTC 1 cut(s) 75
BstAFI CTTAAG 1 cut(s) 152
BstAPI GCANNNNNTGC 1 cut(s) 311
BstDEI CTNAG 5 cut(s) 35, 98, 287, 410, 518
BstF5I GGATG 2 cut(s) 172, 334
BstH2I RGCGCY 1 cut(s) 433
BstHHI GCGC 1 cut(s) 432
BstMAI GTCTC 1 cut(s) 221
BstMWI GCNNNNNNNGC 3 cut(s) 187, 311, 391
BstNI CCWGG 4 cut(s) 270, 318, 331, 441
BstNSI RCATGY 1 cut(s) 109
BstSCI CCNGG 4 cut(s) 268, 316, 329, 439
Bsu36I CCTNAGG 2 cut(s) 98, 287
BsuRI GGCC 2 cut(s) 211, 422
BtgZI GCGATG 1 cut(s) 196
BtsCI GGATG 2 cut(s) 172, 334
BtsIMutI CAGTG 1 cut(s) 375
CfoI GCGC 1 cut(s) 432
Cfr13I GGNCC 2 cut(s) 210, 278
Csp6I GTAC 1 cut(s) 456
CviAII CATG 3 cut(s) 64, 106, 178
CviJI RGCY 7 cut(s) 39, 49, 140, 211, 385, 409, 422
CviKI_1 RGCY 7 cut(s) 39, 49, 140, 211, 385, 409, 422
CviQI GTAC 1 cut(s) 456
DdeI CTNAG 5 cut(s) 35, 98, 287, 410, 518
EaeI YGGCCR 1 cut(s) 420
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
Eco47I GGWCC 1 cut(s) 278
Eco47III AGCGCT 1 cut(s) 431
Eco57I CTGAAG 1 cut(s) 153
Eco81I CCTNAGG 2 cut(s) 98, 287
EcoO109I RGGNCCY 1 cut(s) 210
EcoRI GAATTC 1 cut(s) 522
EcoRII CCWGG 4 cut(s) 268, 316, 329, 439
FaeI CATG 3 cut(s) 67, 109, 181
FaiI YATR 5 cut(s) 32, 65, 107, 179, 533
FaqI GGGAC 2 cut(s) 116, 254
FatI CATG 3 cut(s) 63, 105, 177
FokI GGATG 2 cut(s) 179, 321
FspBI CTAG 1 cut(s) 465
GlaI GCGC 1 cut(s) 431
GsaI CCCAGC 1 cut(s) 43
HaeII RGCGCY 1 cut(s) 433
HaeIII GGCC 2 cut(s) 211, 422
HapII CCGG 1 cut(s) 423
HhaI GCGC 1 cut(s) 432
Hin1II CATG 3 cut(s) 67, 109, 181
Hin6I GCGC 1 cut(s) 430
HinP1I GCGC 1 cut(s) 430
HindIII AAGCTT 1 cut(s) 138
HinfI GANTC 1 cut(s) 19
HpaII CCGG 1 cut(s) 423
HphI GGTGA 1 cut(s) 335
Hpy188I TCNGA 1 cut(s) 413
Hpy188III TCNNGA 1 cut(s) 23
Hpy99I CGWCG 1 cut(s) 408
HpyAV CCTTC 2 cut(s) 67, 269
HpyCH4III ACNGT 1 cut(s) 370
HpyCH4V TGCA 1 cut(s) 190
HpyF10VI GCNNNNNNNGC 3 cut(s) 187, 311, 391
HpyF3I CTNAG 5 cut(s) 35, 98, 287, 410, 518
Hsp92II CATG 3 cut(s) 67, 109, 181
HspAI GCGC 1 cut(s) 430
LmnI GCTCC 2 cut(s) 54, 319
LweI GCATC 3 cut(s) 316, 343, 403
MaeI CTAG 1 cut(s) 465
MaeIII GTNAC 2 cut(s) 364, 482
MboII GAAGA 4 cut(s) 92, 146, 205, 458
MluCI AATT 7 cut(s) 218, 398, 416, 459, 522, 534, 540
MnlI CCTC 6 cut(s) 7, 19, 110, 157, 247, 465
MseI TTAA 2 cut(s) 153, 553
MspCI CTTAAG 1 cut(s) 152
MspI CCGG 1 cut(s) 423
MspR9I CCNGG 4 cut(s) 270, 318, 331, 441
MvaI CCWGG 4 cut(s) 270, 318, 331, 441
MwoI GCNNNNNNNGC 3 cut(s) 187, 311, 391
NlaIII CATG 3 cut(s) 67, 109, 181
NlaIV GGNNCC 1 cut(s) 212
NmuCI GTSAC 1 cut(s) 482
NspI RCATGY 1 cut(s) 109
PciI ACATGT 1 cut(s) 105
PfeI GAWTC 1 cut(s) 19
PscI ACATGT 1 cut(s) 105
PsiI TTATAA 1 cut(s) 533
Psp6I CCWGG 4 cut(s) 268, 316, 329, 439
PspFI CCCAGC 1 cut(s) 39
PspGI CCWGG 4 cut(s) 268, 316, 329, 439
PspN4I GGNNCC 1 cut(s) 212
PspPI GGNCC 2 cut(s) 210, 278
RsaI GTAC 1 cut(s) 457
RsaNI GTAC 1 cut(s) 456
SaqAI TTAA 2 cut(s) 153, 553
Sau96I GGNCC 2 cut(s) 210, 278
ScrFI CCNGG 4 cut(s) 270, 318, 331, 441
SfaNI GCATC 3 cut(s) 316, 343, 403
SinI GGWCC 1 cut(s) 278
SmlI CTYRAG 2 cut(s) 23, 152
SmoI CTYRAG 2 cut(s) 23, 152
SpeI ACTAGT 1 cut(s) 464
Sse9I AATT 7 cut(s) 218, 398, 416, 459, 522, 534, 540
SspMI CTAG 1 cut(s) 465
StyD4I CCNGG 4 cut(s) 268, 316, 329, 439
TaaI ACNGT 1 cut(s) 370
TasI AATT 7 cut(s) 218, 398, 416, 459, 522, 534, 540
TfiI GAWTC 1 cut(s) 19
Tru1I TTAA 2 cut(s) 153, 553
Tru9I TTAA 2 cut(s) 153, 553
TscAI CASTG 1 cut(s) 375
TseFI GTSAC 1 cut(s) 482
Tsp45I GTSAC 1 cut(s) 482
TspDTI ATGAA 3 cut(s) 17, 80, 166
TspGWI ACGGA 1 cut(s) 392
TspRI CASTG 1 cut(s) 375
Vha464I CTTAAG 1 cut(s) 152
VpaK11BI GGWCC 1 cut(s) 278
XapI RAATTY 1 cut(s) 522
XceI RCATGY 1 cut(s) 109
XcmI CCANNNNNNNNNTGG 1 cut(s) 288
XspI CTAG 1 cut(s) 465
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.