Prupe.5G052500_v2.0.a1

Component of the endosomal sorting complex required for transport II (ESCRT-II), which is required for multivesicular body (MVB) formation and sorting of endosomal cargo proteins into MVBs

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
N/A
Physical Location & Seq
Forward (+)
5669562 .. 5671014
1453 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G052500.1_v2.0.a1.CDS.3

Sequence Viewer

Length: 300 bp
GTATTGGGTAATGGTTTTGATGTGATTTCTGTTGGAAAGCGAAAGCTTGTTCGTTCTGTTTCAACTGAGTTGAACAAAGACCATATTGAAATTTTAGAGCTAGCCCAGGCTCAAGGATTTGTGATTGTTGATGAGGTAGAGAGACGGTTATCTTGGACCACTGGCTGTGCAATTGATGCATTCAAGACTTTACTAGATGAGGGTCTTGCAATGATTGATGATGGCCACAAAGATGGTATTCGCCGATATTGGTTCCCTTGTGTATCTTCCATATCGACTCCAGGAGGAGCTGACACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04144 map04144
Pfam Domains
Protein Families
EAP30

Protein Analysis

100

Amino Acids

10.85

Weight (kDa)

5.01

Isoelectric Point (pI)

36.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 223
AcsI RAATTY 1 cut(s) 90
AgsI TTSAA 4 cut(s) 63, 73, 89, 184
AjnI CCWGG 2 cut(s) 105, 280
AluBI AGCT 3 cut(s) 46, 100, 290
AluI AGCT 3 cut(s) 46, 100, 290
Alw26I GTCTC 1 cut(s) 136
AoxI GGCC 1 cut(s) 223
ApoI RAATTY 1 cut(s) 90
AspS9I GGNCC 1 cut(s) 156
AsuNHI GCTAGC 1 cut(s) 100
AvaII GGWCC 1 cut(s) 156
BalI TGGCCA 1 cut(s) 225
BccI CCATC 2 cut(s) 215, 227
BciT130I CCWGG 2 cut(s) 107, 282
BcoDI GTCTC 1 cut(s) 136
BfaI CTAG 2 cut(s) 101, 194
Bme1390I CCNGG 2 cut(s) 107, 282
Bme18I GGWCC 1 cut(s) 156
BmgT120I GGNCC 1 cut(s) 156
BmiI GGNNCC 1 cut(s) 254
BmrFI CCNGG 2 cut(s) 107, 282
BmsI GCATC 1 cut(s) 166
BmtI GCTAGC 1 cut(s) 104
BpmI CTGGAG 1 cut(s) 264
BpuEI CTTGAG 1 cut(s) 96
BsaJI CCNNGG 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 166
Bse3DI GCAATG 1 cut(s) 216
BseBI CCWGG 2 cut(s) 107, 282
BseDI CCNNGG 1 cut(s) 105
BseMI GCAATG 1 cut(s) 216
BseMII CTCAG 1 cut(s) 57
BseNI ACTGG 1 cut(s) 166
BseRI GAGGAG 1 cut(s) 300
BshFI GGCC 1 cut(s) 225
BsmAI GTCTC 1 cut(s) 136
BsmBI CGTCTC 1 cut(s) 136
BsmI GAATGC 1 cut(s) 179
BsnI GGCC 1 cut(s) 225
BspANI GGCC 1 cut(s) 225
BspCNI CTCAG 1 cut(s) 58
BspLI GGNNCC 1 cut(s) 254
BspOI GCTAGC 1 cut(s) 104
BsrDI GCAATG 1 cut(s) 216
BsrI ACTGG 1 cut(s) 166
BssECI CCNNGG 1 cut(s) 105
Bst2UI CCWGG 2 cut(s) 107, 282
Bst4CI ACNGT 1 cut(s) 147
BstAPI GCANNNNNTGC 1 cut(s) 176
BstC8I GCNNGC 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 66
BstMAI GTCTC 1 cut(s) 136
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstNI CCWGG 2 cut(s) 107, 282
BstSCI CCNGG 2 cut(s) 105, 280
BstXI CCANNNNNNTGG 1 cut(s) 233
BsuRI GGCC 1 cut(s) 225
BtsIMutI CAGTG 1 cut(s) 159
Cac8I GCNNGC 1 cut(s) 102
Cfr13I GGNCC 1 cut(s) 156
CviJI RGCY 7 cut(s) 46, 100, 104, 110, 165, 225, 290
CviKI_1 RGCY 7 cut(s) 46, 100, 104, 110, 165, 225, 290
DdeI CTNAG 1 cut(s) 66
EaeI YGGCCR 1 cut(s) 223
Eco47I GGWCC 1 cut(s) 156
EcoRII CCWGG 2 cut(s) 105, 280
EcoT22I ATGCAT 1 cut(s) 181
Esp3I CGTCTC 1 cut(s) 136
FaiI YATR 2 cut(s) 84, 272
FspBI CTAG 2 cut(s) 101, 194
GsuI CTGGAG 1 cut(s) 264
HaeIII GGCC 1 cut(s) 225
HindIII AAGCTT 1 cut(s) 44
HinfI GANTC 1 cut(s) 277
Hpy188III TCNNGA 1 cut(s) 184
HpyCH4III ACNGT 1 cut(s) 147
HpyCH4V TGCA 3 cut(s) 170, 179, 209
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 66
LmnI GCTCC 1 cut(s) 287
LpnPI CCDG 5 cut(s) 92, 119, 147, 267, 294
LweI GCATC 1 cut(s) 166
MaeI CTAG 2 cut(s) 101, 194
MboII GAAGA 1 cut(s) 258
MfeI CAATTG 1 cut(s) 171
MlsI TGGCCA 1 cut(s) 225
MluCI AATT 2 cut(s) 90, 171
MluNI TGGCCA 1 cut(s) 225
MlyI GAGTC 1 cut(s) 271
MmeI TCCRAC 1 cut(s) 13
MnlI CCTC 3 cut(s) 127, 193, 278
Mox20I TGGCCA 1 cut(s) 225
Mph1103I ATGCAT 1 cut(s) 181
MscI TGGCCA 1 cut(s) 225
MseI TTAA 1 cut(s) 298
MslI CAYNNNNRTG 1 cut(s) 231
Msp20I TGGCCA 1 cut(s) 225
MspR9I CCNGG 2 cut(s) 107, 282
MunI CAATTG 1 cut(s) 171
Mva1269I GAATGC 1 cut(s) 179
MvaI CCWGG 2 cut(s) 107, 282
MwoI GCNNNNNNNGC 1 cut(s) 176
NheI GCTAGC 1 cut(s) 100
NlaIV GGNNCC 1 cut(s) 254
NsiI ATGCAT 1 cut(s) 181
PctI GAATGC 1 cut(s) 179
PfoI TCCNGGA 1 cut(s) 280
PleI GAGTC 1 cut(s) 271
PpsI GAGTC 1 cut(s) 271
Psp6I CCWGG 2 cut(s) 105, 280
PspGI CCWGG 2 cut(s) 105, 280
PspN4I GGNNCC 1 cut(s) 254
PspPI GGNCC 1 cut(s) 156
RseI CAYNNNNRTG 1 cut(s) 231
SaqAI TTAA 1 cut(s) 298
Sau96I GGNCC 1 cut(s) 156
SchI GAGTC 1 cut(s) 271
ScrFI CCNGG 2 cut(s) 107, 282
SetI ASST 4 cut(s) 48, 102, 138, 292
SfaNI GCATC 1 cut(s) 166
SinI GGWCC 1 cut(s) 156
SmiMI CAYNNNNRTG 1 cut(s) 231
SmlI CTYRAG 1 cut(s) 111
SmoI CTYRAG 1 cut(s) 111
Sse9I AATT 2 cut(s) 90, 171
SspMI CTAG 2 cut(s) 101, 194
StyD4I CCNGG 2 cut(s) 105, 280
TaaI ACNGT 1 cut(s) 147
TaqI TCGA 1 cut(s) 275
TasI AATT 2 cut(s) 90, 171
Tru1I TTAA 1 cut(s) 298
Tru9I TTAA 1 cut(s) 298
TscAI CASTG 1 cut(s) 166
TspRI CASTG 1 cut(s) 166
VpaK11BI GGWCC 1 cut(s) 156
XapI RAATTY 1 cut(s) 90
XspI CTAG 2 cut(s) 101, 194
Zsp2I ATGCAT 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.