Prupe.5G111500_v2.0.a1

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
N/A
Physical Location & Seq
Reverse (-)
11562732 .. 11563181
450 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G111500.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 450 bp
CTATACTTCCATGAGACTGTTTACAATGGCACAAATGCTGCTGATGCCACATCTGCCATTGTTGCAGCACCTCAAGGAGCCAACTTAACCATCTTGGCACCCCAAAACTATTTTGGGAACATTGTAATCTTCAATGACCTTATAACCCTCGACAACAACATTCACTCTAAGCCTGTTGGCAGGACACAAGGGTTCTACTTGTATGACACAAAGGATACAATCACTGCTTGGTTTGGGTTCTCATTTATTCTCAATAGCACAGACTACCAAGGCAGCATAAATTTCATTGGCCCTAATCCGGTTTTCGTGAAAACTAGGGACATATCCGTCGTGGGGGGCTCTGGAGACTTCTTCATGCACCGGGGCGTTGCAACCCTAAGGACGGATGGGTTTGAAGGGAAATACTTCTTCGGGCTTAGGGTGGATATCAAATTCTACGAATGTTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

150

Amino Acids

16.62

Weight (kDa)

5.44

Isoelectric Point (pI)

29.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 143
AasI GACNNNNNNGTC 1 cut(s) 326
AccB1I GGYRCC 1 cut(s) 97
AcsI RAATTY 2 cut(s) 280, 431
AfiI CCNNNNNNNGG 3 cut(s) 298, 333, 382
AgsI TTSAA 2 cut(s) 133, 395
Alw26I GTCTC 2 cut(s) 8, 339
AoxI GGCC 1 cut(s) 289
ApeKI GCWGC 3 cut(s) 38, 65, 273
ApoI RAATTY 2 cut(s) 280, 431
Asp700I GAANNNNTTC 1 cut(s) 404
AspS9I GGNCC 1 cut(s) 290
AsuC2I CCSGG 1 cut(s) 362
AxyI CCTNAGG 1 cut(s) 377
BanI GGYRCC 1 cut(s) 97
BanII GRGCYC 1 cut(s) 341
BbvI GCAGC 3 cut(s) 25, 77, 285
BccI CCATC 2 cut(s) 98, 380
BciVI GTATCC 1 cut(s) 208
BcnI CCSGG 1 cut(s) 362
BcoDI GTCTC 2 cut(s) 8, 339
BfaI CTAG 1 cut(s) 315
BfuI GTATCC 1 cut(s) 208
BisI GCNGC 3 cut(s) 39, 66, 274
BlsI GCNGC 3 cut(s) 40, 67, 275
Bme1390I CCNGG 1 cut(s) 362
BmgT120I GGNCC 1 cut(s) 290
BmiI GGNNCC 2 cut(s) 79, 99
BmrFI CCNGG 1 cut(s) 362
BmsI GCATC 1 cut(s) 34
BpmI CTGGAG 1 cut(s) 363
Bpu10I CCTNAGC 1 cut(s) 416
BpuEI CTTGAG 1 cut(s) 57
BpuMI CCSGG 1 cut(s) 362
BsaJI CCNNGG 2 cut(s) 268, 361
BsaWI WCCGGW 1 cut(s) 298
Bsc4I CCNNNNNNNGG 3 cut(s) 298, 333, 382
Bse21I CCTNAGG 1 cut(s) 377
BseDI CCNNGG 2 cut(s) 268, 361
BseGI GGATG 1 cut(s) 391
BseLI CCNNNNNNNGG 3 cut(s) 298, 333, 382
BseXI GCAGC 3 cut(s) 25, 77, 285
BshFI GGCC 1 cut(s) 291
BshNI GGYRCC 1 cut(s) 97
BsiSI CCGG 2 cut(s) 299, 361
BslFI GGGAC 1 cut(s) 332
BslI CCNNNNNNNGG 3 cut(s) 298, 333, 382
BsmAI GTCTC 2 cut(s) 8, 339
BsmFI GGGAC 1 cut(s) 332
BsnI GGCC 1 cut(s) 291
Bsp1286I GDGCHC 1 cut(s) 341
BspANI GGCC 1 cut(s) 291
BspLI GGNNCC 2 cut(s) 79, 99
BspT107I GGYRCC 1 cut(s) 97
BssECI CCNNGG 2 cut(s) 268, 361
BssT1I CCWWGG 1 cut(s) 268
Bst4CI ACNGT 1 cut(s) 19
BstDEI CTNAG 3 cut(s) 168, 377, 416
BstF5I GGATG 1 cut(s) 391
BstMAI GTCTC 2 cut(s) 8, 339
BstMWI GCNNNNNNNGC 3 cut(s) 44, 53, 62
BstSCI CCNGG 1 cut(s) 360
BstV1I GCAGC 3 cut(s) 25, 77, 285
Bsu36I CCTNAGG 1 cut(s) 377
BsuI GTATCC 1 cut(s) 208
BsuRI GGCC 1 cut(s) 291
BtsCI GGATG 1 cut(s) 391
BtsI GCAGTG 1 cut(s) 222
BtsIMutI CAGTG 1 cut(s) 222
Cfr13I GGNCC 1 cut(s) 290
CviAII CATG 2 cut(s) 11, 355
CviJI RGCY 5 cut(s) 80, 172, 291, 339, 415
CviKI_1 RGCY 5 cut(s) 80, 172, 291, 339, 415
DdeI CTNAG 3 cut(s) 168, 377, 416
DrdI GACNNNNNNGTC 1 cut(s) 326
DseDI GACNNNNNNGTC 1 cut(s) 326
Eco130I CCWWGG 1 cut(s) 268
Eco24I GRGCYC 1 cut(s) 341
Eco32I GATATC 1 cut(s) 427
Eco81I CCTNAGG 1 cut(s) 377
EcoRV GATATC 1 cut(s) 427
EcoT14I CCWWGG 1 cut(s) 268
EcoT38I GRGCYC 1 cut(s) 341
ErhI CCWWGG 1 cut(s) 268
FaeI CATG 2 cut(s) 14, 358
FaiI YATR 7 cut(s) 4, 12, 143, 204, 278, 323, 356
FaqI GGGAC 1 cut(s) 332
FatI CATG 2 cut(s) 10, 354
Fnu4HI GCNGC 3 cut(s) 39, 66, 274
FokI GGATG 1 cut(s) 398
FriOI GRGCYC 1 cut(s) 341
Fsp4HI GCNGC 3 cut(s) 39, 66, 274
FspBI CTAG 1 cut(s) 315
GluI GCNGC 3 cut(s) 39, 66, 274
GsuI CTGGAG 1 cut(s) 363
HaeIII GGCC 1 cut(s) 291
HapII CCGG 2 cut(s) 299, 361
Hin1II CATG 2 cut(s) 14, 358
HpaII CCGG 2 cut(s) 299, 361
Hpy166II GTNNAC 1 cut(s) 22
Hpy188III TCNNGA 2 cut(s) 307, 342
Hpy8I GTNNAC 1 cut(s) 22
Hpy99I CGWCG 1 cut(s) 332
HpyAV CCTTC 1 cut(s) 389
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4V TGCA 3 cut(s) 65, 358, 371
HpyF10VI GCNNNNNNNGC 3 cut(s) 44, 53, 62
HpyF3I CTNAG 3 cut(s) 168, 377, 416
Hsp92II CATG 2 cut(s) 14, 358
LmnI GCTCC 1 cut(s) 77
LpnPI CCDG 5 cut(s) 166, 186, 312, 327, 374
Lsp1109I GCAGC 3 cut(s) 25, 77, 285
LweI GCATC 1 cut(s) 34
MaeI CTAG 1 cut(s) 315
MboII GAAGA 3 cut(s) 121, 343, 400
MhlI GDGCHC 1 cut(s) 341
MluCI AATT 2 cut(s) 280, 431
MnlI CCTC 2 cut(s) 81, 158
MroXI GAANNNNTTC 1 cut(s) 404
MseI TTAA 1 cut(s) 86
MspI CCGG 2 cut(s) 299, 361
MspR9I CCNGG 1 cut(s) 362
MwoI GCNNNNNNNGC 3 cut(s) 44, 53, 62
NciI CCSGG 1 cut(s) 362
NlaIII CATG 2 cut(s) 14, 358
NlaIV GGNNCC 2 cut(s) 79, 99
PdmI GAANNNNTTC 1 cut(s) 404
PkrI GCNGC 3 cut(s) 40, 67, 275
PsiI TTATAA 1 cut(s) 143
PspN4I GGNNCC 2 cut(s) 79, 99
PspPI GGNCC 1 cut(s) 290
SaqAI TTAA 1 cut(s) 86
SatI GCNGC 3 cut(s) 39, 66, 274
Sau96I GGNCC 1 cut(s) 290
ScrFI CCNGG 1 cut(s) 362
SduI GDGCHC 1 cut(s) 341
SetI ASST 2 cut(s) 73, 141
SfaNI GCATC 1 cut(s) 34
SmlI CTYRAG 1 cut(s) 72
SmoI CTYRAG 1 cut(s) 72
Sse9I AATT 2 cut(s) 280, 431
SspMI CTAG 1 cut(s) 315
StyD4I CCNGG 1 cut(s) 360
StyI CCWWGG 1 cut(s) 268
TaaI ACNGT 1 cut(s) 19
TaqI TCGA 1 cut(s) 150
TasI AATT 2 cut(s) 280, 431
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TscAI CASTG 1 cut(s) 229
TseI GCWGC 3 cut(s) 38, 65, 273
TspDTI ATGAA 2 cut(s) 274, 343
TspGWI ACGGA 2 cut(s) 316, 398
TspRI CASTG 1 cut(s) 229
XapI RAATTY 2 cut(s) 280, 431
XcmI CCANNNNNNNNNTGG 1 cut(s) 110
XmnI GAANNNNTTC 1 cut(s) 404
XspI CTAG 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.