Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp05

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

15675805 .. 15676053

Gene Structure 249 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.5G191000.1_v2.0.a1.CDS.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 249 bp

ATGGTGACAGCCACCCAATTCGACGGCTTCATGCCTATGTGGAACCAGGCTGATTGCATAATGAAGAAAGCAAAGCAGATAAAATCAACTGATGATGTTGAAGGCCTAGAGCTCCTTCGTTGGGAAGATCAGAAGGAAATTAGAAACTATGTACAAAGTGGTGGACCCCCAGATACAATAACAATTAATTATTTCTTTTTCTTGTTTTTGCTTTTGCTTTCGGCGGTAGACAAAGGCATGCAAAGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001101 GO:0003674 GO:0003824 GO:0003909 GO:0003910 GO:0003950 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006139 GO:0006259 GO:0006260 GO:0006261 GO:0006266 GO:0006271 GO:0006273 GO:0006281 GO:0006464 GO:0006471 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0006979 GO:0008150 GO:0008152 GO:0009058 GO:0009059 GO:0009719 GO:0009725 GO:0009737 GO:0009987 GO:0010033 GO:0016070 GO:0016740 GO:0016757 GO:0016763 GO:0016874 GO:0016886 GO:0019538 GO:0022616 GO:0033554 GO:0033993 GO:0034641 GO:0034645 GO:0036211 GO:0042221 GO:0043170 GO:0043412 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044267 GO:0044424 GO:0044464 GO:0046483 GO:0050896 GO:0051103 GO:0051716 GO:0071704 GO:0090304 GO:0097305 GO:0140097 GO:1901360 GO:1901564 GO:1901576 GO:1901700

KEGG Pathways

Metabolic & Signaling

ko03410 ko04210 ko04212 ko04214 ko04217 map03410 map04210 map04212 map04214 map04217

Pfam Domains

Protein Families

BRCT PADR1 PARP PARP_reg WGR zf-PARP

Protein Analysis

83

Amino Acids

9.52

Weight (kDa)

4.89

Isoelectric Point (pI)

31.52

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	228
AciI	CCGC	1 cut(s)	224
AfaI	GTAC	1 cut(s)	153
AfiI	CCNNNNNNNGG	1 cut(s)	121
AgsI	TTSAA	1 cut(s)	101
AjnI	CCWGG	1 cut(s)	45
AluBI	AGCT	1 cut(s)	112
AluI	AGCT	1 cut(s)	112
Alw21I	GWGCWC	1 cut(s)	114
AoxI	GGCC	1 cut(s)	103
AseI	ATTAAT	1 cut(s)	186
AspS9I	GGNCC	1 cut(s)	164
AsuHPI	GGTGA	1 cut(s)	16
AvaII	GGWCC	1 cut(s)	164
BanII	GRGCYC	1 cut(s)	114
Bbv12I	GWGCWC	1 cut(s)	114
BceAI	ACGGC	1 cut(s)	40
BciT130I	CCWGG	1 cut(s)	47
BfaI	CTAG	1 cut(s)	107
Bme1390I	CCNGG	1 cut(s)	47
Bme18I	GGWCC	1 cut(s)	164
BmgT120I	GGNCC	1 cut(s)	164
BmiI	GGNNCC	2 cut(s)	44, 166
BmrFI	CCNGG	1 cut(s)	47
Bsc4I	CCNNNNNNNGG	1 cut(s)	121
BseBI	CCWGG	1 cut(s)	47
BseLI	CCNNNNNNNGG	1 cut(s)	121
BshFI	GGCC	1 cut(s)	105
BsiHKAI	GWGCWC	1 cut(s)	114
BslI	CCNNNNNNNGG	1 cut(s)	121
BsnI	GGCC	1 cut(s)	105
Bsp1286I	GDGCHC	1 cut(s)	114
Bsp1407I	TGTACA	1 cut(s)	151
Bsp143I	GATC	1 cut(s)	127
BspACI	CCGC	1 cut(s)	224
BspANI	GGCC	1 cut(s)	105
BspLI	GGNNCC	2 cut(s)	44, 166
BsrGI	TGTACA	1 cut(s)	151
BssMI	GATC	1 cut(s)	127
Bst2UI	CCWGG	1 cut(s)	47
BstAUI	TGTACA	1 cut(s)	151
BstC8I	GCNNGC	1 cut(s)	239
BstKTI	GATC	1 cut(s)	130
BstMBI	GATC	1 cut(s)	127
BstNI	CCWGG	1 cut(s)	47
BstNSI	RCATGY	1 cut(s)	241
BstSCI	CCNGG	1 cut(s)	45
BsuRI	GGCC	1 cut(s)	105
Cac8I	GCNNGC	1 cut(s)	239
Cfr13I	GGNCC	1 cut(s)	164
Csp6I	GTAC	1 cut(s)	152
CviAII	CATG	2 cut(s)	31, 238
CviJI	RGCY	5 cut(s)	11, 27, 50, 105, 112
CviKI_1	RGCY	5 cut(s)	11, 27, 50, 105, 112
CviQI	GTAC	1 cut(s)	152
DpnI	GATC	1 cut(s)	129
DpnII	GATC	1 cut(s)	127
Ecl136II	GAGCTC	1 cut(s)	112
Eco147I	AGGCCT	1 cut(s)	105
Eco24I	GRGCYC	1 cut(s)	114
Eco47I	GGWCC	1 cut(s)	164
Eco53kI	GAGCTC	1 cut(s)	112
EcoICRI	GAGCTC	1 cut(s)	112
EcoRII	CCWGG	1 cut(s)	45
EcoT38I	GRGCYC	1 cut(s)	114
FaeI	CATG	2 cut(s)	34, 241
FaiI	YATR	5 cut(s)	32, 38, 59, 150, 239
FatI	CATG	2 cut(s)	30, 237
FblI	GTMKAC	1 cut(s)	228
FriOI	GRGCYC	1 cut(s)	114
FspBI	CTAG	1 cut(s)	107
HaeIII	GGCC	1 cut(s)	105
Hin1II	CATG	2 cut(s)	34, 241
HphI	GGTGA	1 cut(s)	16
Hpy166II	GTNNAC	2 cut(s)	164, 229
Hpy188I	TCNGA	1 cut(s)	132
Hpy8I	GTNNAC	2 cut(s)	164, 229
Hpy99I	CGWCG	1 cut(s)	26
HpyAV	CCTTC	3 cut(s)	95, 125, 127
HpyCH4V	TGCA	2 cut(s)	57, 241
Hsp92II	CATG	2 cut(s)	34, 241
Kzo9I	GATC	1 cut(s)	127
LmnI	GCTCC	1 cut(s)	117
LpnPI	CCDG	3 cut(s)	32, 59, 183
MaeI	CTAG	1 cut(s)	107
MaeIII	GTNAC	1 cut(s)	4
MalI	GATC	1 cut(s)	129
MboI	GATC	1 cut(s)	127
MboII	GAAGA	2 cut(s)	76, 137
MhlI	GDGCHC	1 cut(s)	114
MluCI	AATT	4 cut(s)	17, 138, 183, 187
MseI	TTAA	1 cut(s)	186
MslI	CAYNNNNRTG	1 cut(s)	35
MspR9I	CCNGG	1 cut(s)	47
MvaI	CCWGG	1 cut(s)	47
NdeII	GATC	1 cut(s)	127
NlaIII	CATG	2 cut(s)	34, 241
NlaIV	GGNNCC	2 cut(s)	44, 166
NmuCI	GTSAC	1 cut(s)	4
NspI	RCATGY	1 cut(s)	241
PaeI	GCATGC	1 cut(s)	241
PceI	AGGCCT	1 cut(s)	105
PshBI	ATTAAT	1 cut(s)	186
Psp124BI	GAGCTC	1 cut(s)	114
Psp6I	CCWGG	1 cut(s)	45
PspGI	CCWGG	1 cut(s)	45
PspN4I	GGNNCC	2 cut(s)	44, 166
PspPI	GGNCC	1 cut(s)	164
RsaI	GTAC	1 cut(s)	153
RsaNI	GTAC	1 cut(s)	152
RseI	CAYNNNNRTG	1 cut(s)	35
SacI	GAGCTC	1 cut(s)	114
SaqAI	TTAA	1 cut(s)	186
Sau3AI	GATC	1 cut(s)	127
Sau96I	GGNCC	1 cut(s)	164
ScrFI	CCNGG	1 cut(s)	47
SduI	GDGCHC	1 cut(s)	114
SetI	ASST	1 cut(s)	114
SgeI	CNNG	6 cut(s)	43, 58, 59, 119, 182, 214
SinI	GGWCC	1 cut(s)	164
SmiMI	CAYNNNNRTG	1 cut(s)	35
SphI	GCATGC	1 cut(s)	241
Sse9I	AATT	4 cut(s)	17, 138, 183, 187
SseBI	AGGCCT	1 cut(s)	105
SsiI	CCGC	1 cut(s)	224
SspMI	CTAG	1 cut(s)	107
SstI	GAGCTC	1 cut(s)	114
StuI	AGGCCT	1 cut(s)	105
StyD4I	CCNGG	1 cut(s)	45
TaqI	TCGA	1 cut(s)	21
TasI	AATT	4 cut(s)	17, 138, 183, 187
TatI	WGTACW	1 cut(s)	151
Tru1I	TTAA	1 cut(s)	186
Tru9I	TTAA	1 cut(s)	186
TseFI	GTSAC	1 cut(s)	4
Tsp45I	GTSAC	1 cut(s)	4
TspDTI	ATGAA	2 cut(s)	19, 77
VpaK11BI	GGWCC	1 cut(s)	164
VspI	ATTAAT	1 cut(s)	186
XceI	RCATGY	1 cut(s)	241
XmiI	GTMKAC	1 cut(s)	228
XspI	CTAG	1 cut(s)	107

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.