Prupe.6G010400_v2.0.a1

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
N/A
Physical Location & Seq
Forward (+)
788064 .. 788649
586 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G010400.1_v2.0.a1.CDS.2

Sequence Viewer

Length: 507 bp
ATGGCTAGAATCTCTCCCATCTTAACTTTCCAATTCATAATTTCCTCCCTCCTCCTCTCTTCCTCTGCCATGACCTTAGTTTCTGGGGAAAATCATGGGTTTAGAGAAAAGCTCACCCACATTCGCTTGTATTGGCATGACATTGTTGATGGGCCCCATCCCACAGCCATAGATGTGGTCTCACCACCCTCCAAGTCATCACCCACAAATTTTGTGCTAGTGAGAATGTTTGATAATGCACTGACCCAAGGGCCTGAGTTGAGCTCAGAATTGGTGGCAAGGGCTCAAGGGTTTTATGCATCTGCAGCACAAAAGGAGCTTAGCCTGCTGATGGCACAGAACTTTGCTTTTGTTCAAGTTTTCAACAAGGTGAGGGAGCTGCCTGTGATTGGTGGAAGTGGAGTTTTCAGGTTCGCTAAAGGTTATGCTGAAGCAAGTACACACACGTTTGATCTCACCACAGGTGATGCTACGGTGGAGTATAATATTTATGTGTTGCATTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

169

Amino Acids

18.54

Weight (kDa)

6.28

Isoelectric Point (pI)

41.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 208
AcuI CTGAAG 1 cut(s) 450
AfaI GTAC 1 cut(s) 439
AfiI CCNNNNNNNGG 2 cut(s) 331, 389
AflIII ACRYGT 1 cut(s) 444
AgsI TTSAA 2 cut(s) 356, 364
AluBI AGCT 4 cut(s) 112, 264, 319, 379
AluI AGCT 4 cut(s) 112, 264, 319, 379
Alw21I GWGCWC 1 cut(s) 266
Alw26I GTCTC 1 cut(s) 184
AoxI GGCC 2 cut(s) 152, 251
ApaI GGGCCC 1 cut(s) 156
ApeKI GCWGC 2 cut(s) 305, 379
ApoI RAATTY 1 cut(s) 208
AspS9I GGNCC 3 cut(s) 152, 153, 251
AsuHPI GGTGA 6 cut(s) 106, 174, 192, 382, 448, 476
BaeGI GKGCMC 1 cut(s) 156
BanII GRGCYC 3 cut(s) 156, 266, 286
Bbv12I GWGCWC 1 cut(s) 266
BbvI GCAGC 2 cut(s) 317, 366
BccI CCATC 4 cut(s) 26, 143, 165, 325
BcoDI GTCTC 1 cut(s) 184
BfaI CTAG 2 cut(s) 6, 218
BfmI CTRYAG 1 cut(s) 303
BisI GCNGC 2 cut(s) 306, 380
BlpI GCTNAGC 1 cut(s) 320
BlsI GCNGC 2 cut(s) 307, 381
BmgT120I GGNCC 3 cut(s) 152, 153, 251
BmiI GGNNCC 2 cut(s) 154, 155
BmsI GCATC 2 cut(s) 308, 457
BplI GAGNNNNNCTC 4 cut(s) 96, 128, 248, 280
Bpu1102I GCTNAGC 1 cut(s) 320
BpuEI CTTGAG 1 cut(s) 270
BsaI GGTCTC 1 cut(s) 184
BsaJI CCNNGG 1 cut(s) 247
Bsc4I CCNNNNNNNGG 2 cut(s) 331, 389
BseDI CCNNGG 1 cut(s) 247
BseGI GGATG 1 cut(s) 157
BseLI CCNNNNNNNGG 2 cut(s) 331, 389
BseMII CTCAG 2 cut(s) 246, 279
BseRI GAGGAG 2 cut(s) 41, 44
BseSI GKGCMC 1 cut(s) 156
BseXI GCAGC 2 cut(s) 317, 366
BshFI GGCC 2 cut(s) 154, 253
BsiHKAI GWGCWC 1 cut(s) 266
BslI CCNNNNNNNGG 2 cut(s) 331, 389
BsmAI GTCTC 1 cut(s) 184
BsnI GGCC 2 cut(s) 154, 253
Bso31I GGTCTC 1 cut(s) 184
Bsp120I GGGCCC 1 cut(s) 152
Bsp1286I GDGCHC 3 cut(s) 156, 266, 286
Bsp143I GATC 1 cut(s) 451
Bsp1720I GCTNAGC 1 cut(s) 320
BspANI GGCC 2 cut(s) 154, 253
BspCNI CTCAG 2 cut(s) 247, 278
BspLI GGNNCC 2 cut(s) 154, 155
BspMAI CTGCAG 1 cut(s) 307
BspTNI GGTCTC 1 cut(s) 184
BssECI CCNNGG 1 cut(s) 247
BssMI GATC 1 cut(s) 451
BssT1I CCWWGG 1 cut(s) 247
Bst4CI ACNGT 1 cut(s) 475
Bst6I CTCTTC 1 cut(s) 64
BstC8I GCNNGC 1 cut(s) 326
BstDEI CTNAG 4 cut(s) 76, 255, 265, 320
BstF5I GGATG 1 cut(s) 157
BstKTI GATC 1 cut(s) 454
BstMAI GTCTC 1 cut(s) 184
BstMBI GATC 1 cut(s) 451
BstMWI GCNNNNNNNGC 2 cut(s) 305, 325
BstSFI CTRYAG 1 cut(s) 303
BstSLI GKGCMC 1 cut(s) 156
BstV1I GCAGC 2 cut(s) 317, 366
BstXI CCANNNNNNTGG 1 cut(s) 175
BsuRI GGCC 2 cut(s) 154, 253
BtsCI GGATG 1 cut(s) 157
BtsIMutI CAGTG 1 cut(s) 239
Cac8I GCNNGC 1 cut(s) 326
Cfr13I GGNCC 3 cut(s) 152, 153, 251
Csp6I GTAC 1 cut(s) 438
CspCI CAANNNNNGTGG 2 cut(s) 193, 228
CviAII CATG 3 cut(s) 70, 95, 137
CviQI GTAC 1 cut(s) 438
DdeI CTNAG 4 cut(s) 76, 255, 265, 320
DpnI GATC 1 cut(s) 453
DpnII GATC 1 cut(s) 451
Eam1104I CTCTTC 1 cut(s) 64
EarI CTCTTC 1 cut(s) 64
Ecl136II GAGCTC 1 cut(s) 264
Eco130I CCWWGG 1 cut(s) 247
Eco24I GRGCYC 3 cut(s) 156, 266, 286
Eco31I GGTCTC 1 cut(s) 184
Eco53kI GAGCTC 1 cut(s) 264
Eco57I CTGAAG 1 cut(s) 450
EcoICRI GAGCTC 1 cut(s) 264
EcoO109I RGGNCCY 2 cut(s) 153, 251
EcoT14I CCWWGG 1 cut(s) 247
EcoT22I ATGCAT 1 cut(s) 301
EcoT38I GRGCYC 3 cut(s) 156, 266, 286
ErhI CCWWGG 1 cut(s) 247
FaeI CATG 3 cut(s) 73, 98, 140
FaiI YATR 9 cut(s) 38, 71, 96, 138, 170, 297, 426, 483, 492
FatI CATG 3 cut(s) 69, 94, 136
Fnu4HI GCNGC 2 cut(s) 306, 380
FokI GGATG 1 cut(s) 144
FriOI GRGCYC 3 cut(s) 156, 266, 286
Fsp4HI GCNGC 2 cut(s) 306, 380
FspBI CTAG 2 cut(s) 6, 218
GluI GCNGC 2 cut(s) 306, 380
HaeIII GGCC 2 cut(s) 154, 253
Hin1II CATG 3 cut(s) 73, 98, 140
HinfI GANTC 1 cut(s) 9
HphI GGTGA 6 cut(s) 106, 174, 192, 382, 448, 476
Hpy166II GTNNAC 1 cut(s) 440
Hpy188I TCNGA 1 cut(s) 268
Hpy8I GTNNAC 1 cut(s) 440
HpyCH4III ACNGT 1 cut(s) 475
HpyCH4IV ACGT 1 cut(s) 446
HpyCH4V TGCA 4 cut(s) 239, 299, 305, 499
HpyF10VI GCNNNNNNNGC 2 cut(s) 305, 325
HpyF3I CTNAG 4 cut(s) 76, 255, 265, 320
HpySE526I ACGT 1 cut(s) 446
Hsp92II CATG 3 cut(s) 73, 98, 140
Kzo9I GATC 1 cut(s) 451
LmnI GCTCC 2 cut(s) 316, 376
LpnPI CCDG 6 cut(s) 69, 267, 338, 394, 396, 447
Lsp1109I GCAGC 2 cut(s) 317, 366
LweI GCATC 2 cut(s) 308, 457
MaeI CTAG 2 cut(s) 6, 218
MaeII ACGT 1 cut(s) 446
MalI GATC 1 cut(s) 453
MboI GATC 1 cut(s) 451
MboII GAAGA 1 cut(s) 51
MhlI GDGCHC 3 cut(s) 156, 266, 286
MluCI AATT 4 cut(s) 32, 39, 208, 269
MnlI CCTC 7 cut(s) 55, 59, 62, 65, 73, 199, 366
Mph1103I ATGCAT 1 cut(s) 301
MseI TTAA 1 cut(s) 23
MslI CAYNNNNRTG 1 cut(s) 173
MwoI GCNNNNNNNGC 2 cut(s) 305, 325
NdeII GATC 1 cut(s) 451
NlaIII CATG 3 cut(s) 73, 98, 140
NlaIV GGNNCC 2 cut(s) 154, 155
NsiI ATGCAT 1 cut(s) 301
PfeI GAWTC 1 cut(s) 9
PkrI GCNGC 2 cut(s) 307, 381
Psp124BI GAGCTC 1 cut(s) 266
PspN4I GGNNCC 2 cut(s) 154, 155
PspOMI GGGCCC 1 cut(s) 152
PspPI GGNCC 3 cut(s) 152, 153, 251
PstI CTGCAG 1 cut(s) 307
RsaI GTAC 1 cut(s) 439
RsaNI GTAC 1 cut(s) 438
RseI CAYNNNNRTG 1 cut(s) 173
SacI GAGCTC 1 cut(s) 266
SaqAI TTAA 1 cut(s) 23
SatI GCNGC 2 cut(s) 306, 380
Sau3AI GATC 1 cut(s) 451
Sau96I GGNCC 3 cut(s) 152, 153, 251
SduI GDGCHC 3 cut(s) 156, 266, 286
SfaNI GCATC 2 cut(s) 308, 457
SfcI CTRYAG 1 cut(s) 303
SmiMI CAYNNNNRTG 1 cut(s) 173
SmlI CTYRAG 1 cut(s) 285
SmoI CTYRAG 1 cut(s) 285
Sse9I AATT 4 cut(s) 32, 39, 208, 269
SspI AATATT 1 cut(s) 487
SspMI CTAG 2 cut(s) 6, 218
SstI GAGCTC 1 cut(s) 266
StyI CCWWGG 1 cut(s) 247
TaaI ACNGT 1 cut(s) 475
TaiI ACGT 1 cut(s) 449
TasI AATT 4 cut(s) 32, 39, 208, 269
TatI WGTACW 1 cut(s) 437
TfiI GAWTC 1 cut(s) 9
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TscAI CASTG 1 cut(s) 246
TseI GCWGC 2 cut(s) 305, 379
TspDTI ATGAA 1 cut(s) 25
TspRI CASTG 1 cut(s) 246
XapI RAATTY 1 cut(s) 208
XspI CTAG 2 cut(s) 6, 218
Zsp2I ATGCAT 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.