Prupe.6G198300_v2.0.a1

KIX domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
N/A
Physical Location & Seq
Forward (+)
20518281 .. 20520274
1994 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G198300.1_v2.0.a1.CDS.2

Sequence Viewer

Length: 300 bp
ATGGATGCTGACAGGATTGGAGGACCCAGTTTCTCCCAAGTTCACGGCAAAGAATTGTCGTCAAGAATCAAGATAATGGATGCAATAAGGAGGTATCCTCCCTTCTCCTGGGACGGATTAGATGAAATCAGAACTGCTGTAAAGATAGAGGACAAAATTTATGATGTTGCCTTAAGCCAGACGGATTATCTACGGACAATTTCTCTAAAGATGATCATGATTGCGTCGAGGCCTGAGTCTCTTGGCCGAATGCGACCATCAAACCTGAAACGACGTCGCATCCTTGCTAGAGATTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KIX_2

Protein Analysis

100

Amino Acids

11.44

Weight (kDa)

10.07

Isoelectric Point (pI)

63.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 277
AcoI YGGCCR 1 cut(s) 244
AcsI RAATTY 1 cut(s) 156
AcyI GRCGYC 1 cut(s) 274
AfiI CCNNNNNNNGG 1 cut(s) 108
AflII CTTAAG 1 cut(s) 172
AjnI CCWGG 1 cut(s) 107
Alw26I GTCTC 1 cut(s) 243
AoxI GGCC 2 cut(s) 230, 244
ApoI RAATTY 1 cut(s) 156
AspS9I GGNCC 1 cut(s) 23
AvaII GGWCC 1 cut(s) 23
BarI GAAGNNNNNNTAC 2 cut(s) 86, 118
BccI CCATC 1 cut(s) 265
BceAI ACGGC 1 cut(s) 61
BciT130I CCWGG 1 cut(s) 109
BciVI GTATCC 1 cut(s) 105
BclI TGATCA 1 cut(s) 213
BcoDI GTCTC 1 cut(s) 243
BfaI CTAG 1 cut(s) 288
BfrI CTTAAG 1 cut(s) 172
BfuI GTATCC 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 109
Bme18I GGWCC 1 cut(s) 23
BmgT120I GGNCC 1 cut(s) 23
BmiI GGNNCC 1 cut(s) 25
BmrFI CCNGG 1 cut(s) 109
BmrI ACTGGG 1 cut(s) 21
BmsI GCATC 2 cut(s) 70, 288
BmuI ACTGGG 1 cut(s) 21
BplI GAGNNNNNCTC 2 cut(s) 82, 114
BsaHI GRCGYC 1 cut(s) 274
BsaJI CCNNGG 1 cut(s) 108
Bsc4I CCNNNNNNNGG 1 cut(s) 108
Bse1I ACTGG 1 cut(s) 27
BseBI CCWGG 1 cut(s) 109
BseDI CCNNGG 1 cut(s) 108
BseGI GGATG 3 cut(s) 10, 85, 279
BseLI CCNNNNNNNGG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 225
BseNI ACTGG 1 cut(s) 27
BshFI GGCC 2 cut(s) 232, 246
BslFI GGGAC 1 cut(s) 125
BslI CCNNNNNNNGG 1 cut(s) 108
BsmAI GTCTC 1 cut(s) 243
BsmFI GGGAC 1 cut(s) 125
BsmI GAATGC 1 cut(s) 255
BsnI GGCC 2 cut(s) 232, 246
Bsp143I GATC 1 cut(s) 213
BspANI GGCC 2 cut(s) 232, 246
BspCNI CTCAG 1 cut(s) 226
BspHI TCATGA 1 cut(s) 216
BspLI GGNNCC 1 cut(s) 25
BspTI CTTAAG 1 cut(s) 172
BsrI ACTGG 1 cut(s) 27
BssECI CCNNGG 1 cut(s) 108
BssMI GATC 1 cut(s) 213
BssNI GRCGYC 1 cut(s) 274
Bst2UI CCWGG 1 cut(s) 109
BstACI GRCGYC 1 cut(s) 274
BstAFI CTTAAG 1 cut(s) 172
BstDEI CTNAG 1 cut(s) 234
BstF5I GGATG 3 cut(s) 10, 85, 279
BstKTI GATC 1 cut(s) 216
BstMAI GTCTC 1 cut(s) 243
BstMBI GATC 1 cut(s) 213
BstNI CCWGG 1 cut(s) 109
BstSCI CCNGG 1 cut(s) 107
BsuI GTATCC 1 cut(s) 105
BsuRI GGCC 2 cut(s) 232, 246
BtsCI GGATG 3 cut(s) 10, 85, 279
CciI TCATGA 1 cut(s) 216
Cfr13I GGNCC 1 cut(s) 23
CseI GACGC 1 cut(s) 213
CviAII CATG 1 cut(s) 217
CviJI RGCY 3 cut(s) 177, 232, 246
CviKI_1 RGCY 3 cut(s) 177, 232, 246
DdeI CTNAG 1 cut(s) 234
DpnI GATC 1 cut(s) 215
DpnII GATC 1 cut(s) 213
EaeI YGGCCR 1 cut(s) 244
Eco147I AGGCCT 1 cut(s) 232
Eco47I GGWCC 1 cut(s) 23
EcoO109I RGGNCCY 1 cut(s) 23
EcoRII CCWGG 1 cut(s) 107
FaeI CATG 1 cut(s) 220
FaiI YATR 2 cut(s) 162, 218
FaqI GGGAC 1 cut(s) 125
FatI CATG 1 cut(s) 216
FbaI TGATCA 1 cut(s) 213
FokI GGATG 3 cut(s) 17, 92, 266
FspBI CTAG 1 cut(s) 288
HaeIII GGCC 2 cut(s) 232, 246
HgaI GACGC 1 cut(s) 213
Hin1I GRCGYC 1 cut(s) 274
Hin1II CATG 1 cut(s) 220
HinfI GANTC 2 cut(s) 66, 236
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 1 cut(s) 131
Hpy188III TCNNGA 3 cut(s) 63, 70, 217
Hpy8I GTNNAC 1 cut(s) 43
Hpy99I CGWCG 3 cut(s) 229, 276, 279
HpyAV CCTTC 1 cut(s) 112
HpyCH4IV ACGT 1 cut(s) 274
HpyCH4V TGCA 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 234
HpySE526I ACGT 1 cut(s) 274
Hsp92I GRCGYC 1 cut(s) 274
Hsp92II CATG 1 cut(s) 220
Ksp22I TGATCA 1 cut(s) 213
Kzo9I GATC 1 cut(s) 213
LpnPI CCDG 6 cut(s) 40, 94, 121, 191, 246, 278
LweI GCATC 2 cut(s) 70, 288
MaeI CTAG 1 cut(s) 288
MaeII ACGT 1 cut(s) 274
MalI GATC 1 cut(s) 215
MboI GATC 1 cut(s) 213
MluCI AATT 3 cut(s) 53, 156, 198
MlyI GAGTC 1 cut(s) 245
MnlI CCTC 5 cut(s) 14, 84, 108, 142, 222
MseI TTAA 1 cut(s) 173
MspCI CTTAAG 1 cut(s) 172
MspR9I CCNGG 1 cut(s) 109
Mva1269I GAATGC 1 cut(s) 255
MvaI CCWGG 1 cut(s) 109
NdeII GATC 1 cut(s) 213
NlaIII CATG 1 cut(s) 220
NlaIV GGNNCC 1 cut(s) 25
PagI TCATGA 1 cut(s) 216
PceI AGGCCT 1 cut(s) 232
PctI GAATGC 1 cut(s) 255
PfeI GAWTC 1 cut(s) 66
PleI GAGTC 1 cut(s) 244
PpsI GAGTC 1 cut(s) 244
PpuMI RGGWCCY 1 cut(s) 23
Psp5II RGGWCCY 1 cut(s) 23
Psp6I CCWGG 1 cut(s) 107
PspGI CCWGG 1 cut(s) 107
PspN4I GGNNCC 1 cut(s) 25
PspPI GGNCC 1 cut(s) 23
PspPPI RGGWCCY 1 cut(s) 23
SaqAI TTAA 1 cut(s) 173
Sau3AI GATC 1 cut(s) 213
Sau96I GGNCC 1 cut(s) 23
SchI GAGTC 1 cut(s) 245
ScrFI CCNGG 1 cut(s) 109
SetI ASST 3 cut(s) 95, 267, 277
SfaNI GCATC 2 cut(s) 70, 288
SinI GGWCC 1 cut(s) 23
SmlI CTYRAG 1 cut(s) 172
SmoI CTYRAG 1 cut(s) 172
Sse9I AATT 3 cut(s) 53, 156, 198
SseBI AGGCCT 1 cut(s) 232
SspMI CTAG 1 cut(s) 288
StuI AGGCCT 1 cut(s) 232
StyD4I CCNGG 1 cut(s) 107
TaiI ACGT 1 cut(s) 277
TaqI TCGA 1 cut(s) 227
TasI AATT 3 cut(s) 53, 156, 198
TfiI GAWTC 1 cut(s) 66
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
TspDTI ATGAA 1 cut(s) 138
TspGWI ACGGA 3 cut(s) 129, 197, 208
Vha464I CTTAAG 1 cut(s) 172
VpaK11BI GGWCC 1 cut(s) 23
XapI RAATTY 1 cut(s) 156
XspI CTAG 1 cut(s) 288
ZraI GACGTC 1 cut(s) 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.