Prupe.6G276400_v2.0.a1

ubiquitin-protein transferase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
N/A
Physical Location & Seq
Reverse (-)
26007593 .. 26007835
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G276400.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 243 bp
ATGCCAAGAGTGATCATCTCTCATGACCTGGTCCAAGAGTGCCATATCTGCTTGGAAGAGTTGAAGGTCGGTGATGAAGCCACAAAGGTGCCTTGTAAATGCAAGCGCATTTACTTTCACCGGCTTTGCCTCCAGAAATGGTGCCTTGTACAACCTTCATGCCCTGTCTGTTACGTCCCCTGTTATGTGATGATCAACTACACCAAGAAAACAAATTTCTTCCAAAAATTGTGGTGTTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
zf-RING_2

Protein Analysis

81

Amino Acids

9.56

Weight (kDa)

8.72

Isoelectric Point (pI)

60.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 88, 141
AcsI RAATTY 1 cut(s) 214
AfaI GTAC 1 cut(s) 150
AgsI TTSAA 1 cut(s) 64
AjnI CCWGG 1 cut(s) 27
AleI CACNNNNGTG 1 cut(s) 86
ApoI RAATTY 1 cut(s) 214
AspLEI GCGC 1 cut(s) 108
AspS9I GGNCC 1 cut(s) 31
AsuHPI GGTGA 2 cut(s) 83, 110
AvaII GGWCC 1 cut(s) 31
BanI GGYRCC 2 cut(s) 88, 141
BciT130I CCWGG 1 cut(s) 29
BclI TGATCA 2 cut(s) 12, 192
Bme1390I CCNGG 1 cut(s) 29
Bme18I GGWCC 1 cut(s) 31
BmgT120I GGNCC 1 cut(s) 31
BmiI GGNNCC 2 cut(s) 90, 143
BmrFI CCNGG 1 cut(s) 29
BpmI CTGGAG 1 cut(s) 116
Bse118I RCCGGY 1 cut(s) 120
BseBI CCWGG 1 cut(s) 29
BshNI GGYRCC 2 cut(s) 88, 141
BsiSI CCGG 1 cut(s) 121
BslFI GGGAC 1 cut(s) 161
BsmFI GGGAC 1 cut(s) 161
Bsp1407I TGTACA 1 cut(s) 148
Bsp143I GATC 2 cut(s) 12, 192
BspHI TCATGA 1 cut(s) 22
BspLI GGNNCC 2 cut(s) 90, 143
BspT107I GGYRCC 2 cut(s) 88, 141
BsrFI RCCGGY 1 cut(s) 120
BsrGI TGTACA 1 cut(s) 148
BssAI RCCGGY 1 cut(s) 120
BssMI GATC 2 cut(s) 12, 192
Bst2UI CCWGG 1 cut(s) 29
Bst6I CTCTTC 1 cut(s) 51
BstAUI TGTACA 1 cut(s) 148
BstC8I GCNNGC 1 cut(s) 104
BstHHI GCGC 1 cut(s) 108
BstKTI GATC 2 cut(s) 15, 195
BstMBI GATC 2 cut(s) 12, 192
BstMWI GCNNNNNNNGC 1 cut(s) 48
BstNI CCWGG 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 27
Cac8I GCNNGC 1 cut(s) 104
CciI TCATGA 1 cut(s) 22
CfoI GCGC 1 cut(s) 108
Cfr10I RCCGGY 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 31
CsiI ACCWGGT 1 cut(s) 27
Csp6I GTAC 1 cut(s) 149
CspCI CAANNNNNGTGG 1 cut(s) 212
CviAII CATG 2 cut(s) 23, 159
CviJI RGCY 2 cut(s) 80, 124
CviKI_1 RGCY 2 cut(s) 80, 124
CviQI GTAC 1 cut(s) 149
DpnI GATC 2 cut(s) 14, 194
DpnII GATC 2 cut(s) 12, 192
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco47I GGWCC 1 cut(s) 31
EcoRII CCWGG 1 cut(s) 27
FaeI CATG 2 cut(s) 26, 162
FaiI YATR 4 cut(s) 24, 45, 160, 186
FaqI GGGAC 1 cut(s) 161
FatI CATG 2 cut(s) 22, 158
FbaI TGATCA 2 cut(s) 12, 192
GlaI GCGC 1 cut(s) 107
GsuI CTGGAG 1 cut(s) 116
HapII CCGG 1 cut(s) 121
HhaI GCGC 1 cut(s) 108
Hin1II CATG 2 cut(s) 26, 162
Hin6I GCGC 1 cut(s) 106
HinP1I GCGC 1 cut(s) 106
HpaII CCGG 1 cut(s) 121
HphI GGTGA 2 cut(s) 83, 110
Hpy188III TCNNGA 2 cut(s) 23, 133
HpyAV CCTTC 2 cut(s) 58, 165
HpyCH4IV ACGT 1 cut(s) 174
HpyCH4V TGCA 1 cut(s) 102
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
HpySE526I ACGT 1 cut(s) 174
Hsp92II CATG 2 cut(s) 26, 162
HspAI GCGC 1 cut(s) 106
Ksp22I TGATCA 2 cut(s) 12, 192
Kzo9I GATC 2 cut(s) 12, 192
LpnPI CCDG 6 cut(s) 14, 41, 134, 146, 177, 193
MabI ACCWGGT 1 cut(s) 27
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 1 cut(s) 170
MalI GATC 2 cut(s) 14, 194
MboI GATC 2 cut(s) 12, 192
MboII GAAGA 2 cut(s) 68, 211
MluCI AATT 2 cut(s) 214, 227
MnlI CCTC 1 cut(s) 140
MslI CAYNNNNRTG 1 cut(s) 86
MspI CCGG 1 cut(s) 121
MspR9I CCNGG 1 cut(s) 29
MvaI CCWGG 1 cut(s) 29
MwoI GCNNNNNNNGC 1 cut(s) 48
NdeII GATC 2 cut(s) 12, 192
NlaIII CATG 2 cut(s) 26, 162
NlaIV GGNNCC 2 cut(s) 90, 143
OliI CACNNNNGTG 1 cut(s) 86
PagI TCATGA 1 cut(s) 22
PflFI GACNNNGTC 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 27
PspGI CCWGG 1 cut(s) 27
PspN4I GGNNCC 2 cut(s) 90, 143
PspPI GGNCC 1 cut(s) 31
PsyI GACNNNGTC 1 cut(s) 29
RsaI GTAC 1 cut(s) 150
RsaNI GTAC 1 cut(s) 149
RseI CAYNNNNRTG 1 cut(s) 86
Sau3AI GATC 2 cut(s) 12, 192
Sau96I GGNCC 1 cut(s) 31
ScrFI CCNGG 1 cut(s) 29
SetI ASST 5 cut(s) 30, 69, 90, 157, 177
SexAI ACCWGGT 1 cut(s) 27
SinI GGWCC 1 cut(s) 31
SmiMI CAYNNNNRTG 1 cut(s) 86
Sse9I AATT 2 cut(s) 214, 227
StyD4I CCNGG 1 cut(s) 27
TaiI ACGT 1 cut(s) 177
TasI AATT 2 cut(s) 214, 227
TatI WGTACW 1 cut(s) 148
TspDTI ATGAA 2 cut(s) 90, 147
Tth111I GACNNNGTC 1 cut(s) 29
VpaK11BI GGWCC 1 cut(s) 31
XapI RAATTY 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.