Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp07

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Reverse (-)

1193648 .. 1195143

Gene Structure 1496 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.7G008800.1_v2.0.a1.CDS.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

ATGGGTGTGAAGATATATGGATTGAATGATGCTTATTTATTCAGCATATTTACCGACGTCTTAAAGCAACGTAACAATGAAGAACCACGACGCTATTGTGAAGCAATTATTCAGGATATCACGTCGTGTGCGGCCAACTCTACCCAGGATTGTAGGAAGTTGGACCCCAATGGAATTGTGGTACTTCACCAGACAGATATTGGAGAGTACTTGAGGATGGAGGATGAGCTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000463 GO:0000470 GO:0003674 GO:0003676 GO:0003723 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005730 GO:0005737 GO:0005829 GO:0006139 GO:0006364 GO:0006396 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0010467 GO:0016043 GO:0016070 GO:0016072 GO:0022607 GO:0022613 GO:0022618 GO:0030684 GO:0030687 GO:0031974 GO:0031981 GO:0032991 GO:0034470 GO:0034622 GO:0034641 GO:0034660 GO:0042254 GO:0042273 GO:0043170 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043233 GO:0043933 GO:0044085 GO:0044237 GO:0044238 GO:0044422 GO:0044424 GO:0044428 GO:0044444 GO:0044446 GO:0044464 GO:0046483 GO:0065003 GO:0070013 GO:0071704 GO:0071826 GO:0071840 GO:0090304 GO:0097159 GO:1901360 GO:1901363 GO:1902626 GO:1990904

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

UPF0113

Protein Analysis

78

Amino Acids

8.86

Weight (kDa)

4.61

Isoelectric Point (pI)

30.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	60
AciI	CCGC	1 cut(s)	131
AcoI	YGGCCR	1 cut(s)	132
AcyI	GRCGYC	1 cut(s)	57
AdeI	CACNNNGTG	1 cut(s)	126
AfaI	GTAC	2 cut(s)	183, 209
AgsI	TTSAA	1 cut(s)	25
AjiI	CACGTC	1 cut(s)	123
AjnI	CCWGG	1 cut(s)	144
AluBI	AGCT	1 cut(s)	229
AluI	AGCT	1 cut(s)	229
AoxI	GGCC	1 cut(s)	132
AspS9I	GGNCC	1 cut(s)	163
AsuHPI	GGTGA	1 cut(s)	179
AvaII	GGWCC	1 cut(s)	163
BccI	CCATC	1 cut(s)	211
BciT130I	CCWGG	1 cut(s)	146
BisI	GCNGC	1 cut(s)	132
BlsI	GCNGC	1 cut(s)	133
BmcAI	AGTACT	1 cut(s)	209
Bme1390I	CCNGG	1 cut(s)	146
Bme18I	GGWCC	1 cut(s)	163
BmgBI	CACGTC	1 cut(s)	123
BmgT120I	GGNCC	1 cut(s)	163
BmiI	GGNNCC	1 cut(s)	165
BmrFI	CCNGG	1 cut(s)	146
BmsI	GCATC	1 cut(s)	19
BpuEI	CTTGAG	1 cut(s)	232
BsaHI	GRCGYC	1 cut(s)	57
BsaJI	CCNNGG	1 cut(s)	144
BseBI	CCWGG	1 cut(s)	146
BseDI	CCNNGG	1 cut(s)	144
BseGI	GGATG	2 cut(s)	222, 229
BshFI	GGCC	1 cut(s)	134
BsnI	GGCC	1 cut(s)	134
BspACI	CCGC	1 cut(s)	131
BspANI	GGCC	1 cut(s)	134
BspLI	GGNNCC	1 cut(s)	165
BssECI	CCNNGG	1 cut(s)	144
BssNI	GRCGYC	1 cut(s)	57
Bst2UI	CCWGG	1 cut(s)	146
BstACI	GRCGYC	1 cut(s)	57
BstF5I	GGATG	2 cut(s)	222, 229
BstNI	CCWGG	1 cut(s)	146
BstSCI	CCNGG	1 cut(s)	144
BsuRI	GGCC	1 cut(s)	134
BtrI	CACGTC	1 cut(s)	123
BtsCI	GGATG	2 cut(s)	222, 229
Cfr13I	GGNCC	1 cut(s)	163
CseI	GACGC	1 cut(s)	99
Csp6I	GTAC	2 cut(s)	182, 208
CviJI	RGCY	2 cut(s)	134, 229
CviKI_1	RGCY	2 cut(s)	134, 229
CviQI	GTAC	2 cut(s)	182, 208
DraIII	CACNNNGTG	1 cut(s)	126
EaeI	YGGCCR	1 cut(s)	132
Eco32I	GATATC	1 cut(s)	118
Eco47I	GGWCC	1 cut(s)	163
EcoRII	CCWGG	1 cut(s)	144
EcoRV	GATATC	1 cut(s)	118
FaiI	YATR	3 cut(s)	16, 18, 47
Fnu4HI	GCNGC	1 cut(s)	132
FokI	GGATG	1 cut(s)	229
Fsp4HI	GCNGC	1 cut(s)	132
GluI	GCNGC	1 cut(s)	132
HaeIII	GGCC	1 cut(s)	134
HgaI	GACGC	1 cut(s)	99
Hin1I	GRCGYC	1 cut(s)	57
HphI	GGTGA	1 cut(s)	179
Hpy188III	TCNNGA	1 cut(s)	113
Hpy99I	CGWCG	3 cut(s)	59, 93, 127
HpyCH4IV	ACGT	3 cut(s)	57, 70, 122
HpySE526I	ACGT	3 cut(s)	57, 70, 122
Hsp92I	GRCGYC	1 cut(s)	57
LpnPI	CCDG	4 cut(s)	98, 131, 158, 203
LweI	GCATC	1 cut(s)	19
MaeII	ACGT	3 cut(s)	57, 70, 122
MaeIII	GTNAC	1 cut(s)	71
MboII	GAAGA	2 cut(s)	22, 92
MluCI	AATT	2 cut(s)	105, 174
MmeI	TCCRAC	1 cut(s)	141
MnlI	CCTC	2 cut(s)	207, 214
MseI	TTAA	1 cut(s)	62
MspR9I	CCNGG	1 cut(s)	146
MvaI	CCWGG	1 cut(s)	146
NlaIV	GGNNCC	1 cut(s)	165
PkrI	GCNGC	1 cut(s)	133
Psp6I	CCWGG	1 cut(s)	144
PspGI	CCWGG	1 cut(s)	144
PspN4I	GGNNCC	1 cut(s)	165
PspPI	GGNCC	1 cut(s)	163
RsaI	GTAC	2 cut(s)	183, 209
RsaNI	GTAC	2 cut(s)	182, 208
SaqAI	TTAA	1 cut(s)	62
SatI	GCNGC	1 cut(s)	132
Sau96I	GGNCC	1 cut(s)	163
ScaI	AGTACT	1 cut(s)	209
ScrFI	CCNGG	1 cut(s)	146
SetI	ASST	4 cut(s)	60, 73, 125, 231
SfaNI	GCATC	1 cut(s)	19
SgeI	CNNG	8 cut(s)	99, 125, 133, 138, 157, 158, 202, 223
SinI	GGWCC	1 cut(s)	163
SmlI	CTYRAG	1 cut(s)	211
SmoI	CTYRAG	1 cut(s)	211
Sse9I	AATT	2 cut(s)	105, 174
SsiI	CCGC	1 cut(s)	131
StyD4I	CCNGG	1 cut(s)	144
TaiI	ACGT	3 cut(s)	60, 73, 125
TasI	AATT	2 cut(s)	105, 174
TatI	WGTACW	1 cut(s)	207
TauI	GCSGC	1 cut(s)	134
Tru1I	TTAA	1 cut(s)	62
Tru9I	TTAA	1 cut(s)	62
TspDTI	ATGAA	1 cut(s)	93
VpaK11BI	GGWCC	1 cut(s)	163
XcmI	CCANNNNNNNNNTGG	2 cut(s)	175, 197
ZraI	GACGTC	1 cut(s)	58
ZrmI	AGTACT	1 cut(s)	209

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.