Prupe.7G193400_v2.0.a1

peroxiredoxin activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
N/A
Physical Location & Seq
Forward (+)
18399857 .. 18401416
1560 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G193400.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 288 bp
ATGCACACCGGCACCAAGATACCAAGTTTTGAGACAATTGGAGCCATAGTTGCTGGATCTTGGTGTGTTTCAAAGCTTTTTTGGTTTGAAAGTTTTAAATTTATGTGGGCTTTTGCAAAGAAATACAAACTTCCGTCCACATTACTAAGCGAGCAGGGTAATAAGGTGAGGAAATGGGGAGTGCCATCAGATCTGTTTGGGACATTGCCTGGCAGACAGATGCAACAACCAGTTACAACCTCAGAAGCATATACTGATGAAACTCTCAAACTCCTTCAAAGCCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AhpC-TSA

Protein Analysis

96

Amino Acids

10.75

Weight (kDa)

9.42

Isoelectric Point (pI)

35.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 11
AclWI GGATC 1 cut(s) 64
AcsI RAATTY 1 cut(s) 98
AgsI TTSAA 3 cut(s) 72, 89, 278
AjnI CCWGG 1 cut(s) 208
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
Alw26I GTCTC 1 cut(s) 26
AlwI GGATC 1 cut(s) 64
ApoI RAATTY 1 cut(s) 98
AsuHPI GGTGA 1 cut(s) 178
BanI GGYRCC 1 cut(s) 11
BccI CCATC 1 cut(s) 193
BciT130I CCWGG 1 cut(s) 210
BcoDI GTCTC 1 cut(s) 26
BglII AGATCT 1 cut(s) 190
Bme1390I CCNGG 1 cut(s) 210
BmiI GGNNCC 2 cut(s) 13, 43
BmrFI CCNGG 1 cut(s) 210
BmsI GCATC 1 cut(s) 210
BsaXI ACNNNNNCTCC 2 cut(s) 33, 63
Bse118I RCCGGY 1 cut(s) 8
Bse1I ACTGG 1 cut(s) 230
Bse3DI GCAATG 1 cut(s) 203
BseBI CCWGG 1 cut(s) 210
BseMI GCAATG 1 cut(s) 203
BseMII CTCAG 1 cut(s) 255
BseNI ACTGG 1 cut(s) 230
BshNI GGYRCC 1 cut(s) 11
BsiSI CCGG 1 cut(s) 9
BslFI GGGAC 1 cut(s) 214
BsmAI GTCTC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 214
Bsp143I GATC 2 cut(s) 56, 190
BspCNI CTCAG 1 cut(s) 254
BspLI GGNNCC 2 cut(s) 13, 43
BspPI GGATC 1 cut(s) 64
BspT107I GGYRCC 1 cut(s) 11
BsrDI GCAATG 1 cut(s) 203
BsrFI RCCGGY 1 cut(s) 8
BsrI ACTGG 1 cut(s) 230
BssAI RCCGGY 1 cut(s) 8
BssMI GATC 2 cut(s) 56, 190
Bst2UI CCWGG 1 cut(s) 210
BstC8I GCNNGC 1 cut(s) 152
BstDEI CTNAG 2 cut(s) 146, 241
BstKTI GATC 2 cut(s) 59, 193
BstMAI GTCTC 1 cut(s) 26
BstMBI GATC 2 cut(s) 56, 190
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 210
BstSCI CCNGG 1 cut(s) 208
BstX2I RGATCY 2 cut(s) 56, 190
BstYI RGATCY 2 cut(s) 56, 190
Cac8I GCNNGC 1 cut(s) 152
Cfr10I RCCGGY 1 cut(s) 8
CviJI RGCY 4 cut(s) 44, 76, 110, 282
CviKI_1 RGCY 4 cut(s) 44, 76, 110, 282
DdeI CTNAG 2 cut(s) 146, 241
DpnI GATC 2 cut(s) 58, 192
DpnII GATC 2 cut(s) 56, 190
DraI TTTAAA 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 208
FaiI YATR 4 cut(s) 47, 104, 250, 252
FaqI GGGAC 1 cut(s) 214
HapII CCGG 1 cut(s) 9
HindIII AAGCTT 1 cut(s) 74
HpaII CCGG 1 cut(s) 9
HphI GGTGA 1 cut(s) 178
Hpy166II GTNNAC 1 cut(s) 138
Hpy188I TCNGA 2 cut(s) 190, 244
Hpy8I GTNNAC 1 cut(s) 138
HpyAV CCTTC 1 cut(s) 284
HpyCH4V TGCA 3 cut(s) 4, 116, 223
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 2 cut(s) 146, 241
Kzo9I GATC 2 cut(s) 56, 190
LmnI GCTCC 1 cut(s) 41
LpnPI CCDG 6 cut(s) 22, 39, 140, 195, 222, 243
LweI GCATC 1 cut(s) 210
MaeIII GTNAC 1 cut(s) 232
MalI GATC 2 cut(s) 58, 192
MboI GATC 2 cut(s) 56, 190
MfeI CAATTG 1 cut(s) 36
MflI RGATCY 2 cut(s) 56, 190
MluCI AATT 2 cut(s) 36, 98
MnlI CCTC 2 cut(s) 162, 250
MseI TTAA 2 cut(s) 96, 286
MspI CCGG 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 210
MunI CAATTG 1 cut(s) 36
MvaI CCWGG 1 cut(s) 210
MwoI GCNNNNNNNGC 1 cut(s) 50
NdeII GATC 2 cut(s) 56, 190
NlaIV GGNNCC 2 cut(s) 13, 43
Psp6I CCWGG 1 cut(s) 208
PspGI CCWGG 1 cut(s) 208
PspN4I GGNNCC 2 cut(s) 13, 43
PsuI RGATCY 2 cut(s) 56, 190
SaqAI TTAA 2 cut(s) 96, 286
Sau3AI GATC 2 cut(s) 56, 190
ScrFI CCNGG 1 cut(s) 210
SetI ASST 3 cut(s) 78, 168, 242
SfaNI GCATC 1 cut(s) 210
Sse9I AATT 2 cut(s) 36, 98
StyD4I CCNGG 1 cut(s) 208
TasI AATT 2 cut(s) 36, 98
Tru1I TTAA 2 cut(s) 96, 286
Tru9I TTAA 2 cut(s) 96, 286
TspDTI ATGAA 1 cut(s) 273
TspGWI ACGGA 1 cut(s) 123
XapI RAATTY 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.