pycom01g11590
NAC Family

(NAC) domain-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
N/A
Physical Location & Seq
Reverse (-)
12626080 .. 12631507
5428 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g11590.1

Sequence Viewer

Length: 366 bp
ATGGGAGAAATTCTGAATTCATCTTCTCAACCGCTGCAGCCACCGCAGCCACATCAGCCACCACACCACCGTTACACACTATGTAAGAGATTGAATAATATTTCTTATCCTGAATATAAGAATAATATTTCAACCAATTATCCCAACGAGCAAGTTAACAAGCTGGCTAGTGGTGTTCCAATTCAAGCTACAGATGAAGGAATTTTCAGAGGCTTCTTTAGTCCAGAAGAATATATGGGTCCTCTGTTTGATCCATCTTCGTTACAAGATTACTTGTTGCTGTCACCAATGAACACAGAACTAGATGTTGTGCATACCAATAACTATATTGGATGCAATGATATCATTGTTGACCAGGATTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

13.81

Weight (kDa)

4.65

Isoelectric Point (pI)

65.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 32, 44
AclWI GGATC 1 cut(s) 245
AcsI RAATTY 3 cut(s) 9, 16, 201
AgsI TTSAA 3 cut(s) 94, 132, 185
AjnI CCWGG 1 cut(s) 354
AluBI AGCT 2 cut(s) 163, 188
AluI AGCT 2 cut(s) 163, 188
AlwI GGATC 1 cut(s) 245
ApeKI GCWGC 3 cut(s) 34, 37, 46
ApoI RAATTY 3 cut(s) 9, 16, 201
AspS9I GGNCC 1 cut(s) 239
AsuHPI GGTGA 1 cut(s) 276
AvaII GGWCC 1 cut(s) 239
BbvI GCAGC 3 cut(s) 21, 49, 58
BccI CCATC 1 cut(s) 262
BciT130I CCWGG 1 cut(s) 356
BfaI CTAG 2 cut(s) 168, 302
BfmI CTRYAG 2 cut(s) 35, 189
BisI GCNGC 3 cut(s) 35, 38, 47
BlsI GCNGC 3 cut(s) 36, 39, 48
Bme1390I CCNGG 1 cut(s) 356
Bme18I GGWCC 1 cut(s) 239
BmgT120I GGNCC 1 cut(s) 239
BmiI GGNNCC 1 cut(s) 240
BmrFI CCNGG 1 cut(s) 356
BmsI GCATC 1 cut(s) 323
Bse3DI GCAATG 1 cut(s) 343
BseBI CCWGG 1 cut(s) 356
BseGI GGATG 1 cut(s) 338
BseMI GCAATG 1 cut(s) 343
BseXI GCAGC 3 cut(s) 21, 49, 58
Bsp143I GATC 1 cut(s) 250
BspACI CCGC 2 cut(s) 32, 44
BspLI GGNNCC 1 cut(s) 240
BspMAI CTGCAG 1 cut(s) 39
BspPI GGATC 1 cut(s) 245
BsrDI GCAATG 1 cut(s) 343
BssMI GATC 1 cut(s) 250
Bst2UI CCWGG 1 cut(s) 356
Bst4CI ACNGT 1 cut(s) 71
BstC8I GCNNGC 1 cut(s) 165
BstF5I GGATG 1 cut(s) 338
BstKTI GATC 1 cut(s) 253
BstMBI GATC 1 cut(s) 250
BstMWI GCNNNNNNNGC 3 cut(s) 43, 46, 55
BstNI CCWGG 1 cut(s) 356
BstSCI CCNGG 1 cut(s) 354
BstSFI CTRYAG 2 cut(s) 35, 189
BstV1I GCAGC 3 cut(s) 21, 49, 58
BtsCI GGATG 1 cut(s) 338
Cac8I GCNNGC 1 cut(s) 165
Cfr13I GGNCC 1 cut(s) 239
CviJI RGCY 7 cut(s) 40, 49, 58, 163, 167, 188, 213
CviKI_1 RGCY 7 cut(s) 40, 49, 58, 163, 167, 188, 213
DpnI GATC 1 cut(s) 252
DpnII GATC 1 cut(s) 250
Eco32I GATATC 1 cut(s) 343
Eco47I GGWCC 1 cut(s) 239
EcoO109I RGGNCCY 1 cut(s) 239
EcoRI GAATTC 1 cut(s) 16
EcoRII CCWGG 1 cut(s) 354
EcoRV GATATC 1 cut(s) 343
FaiI YATR 6 cut(s) 82, 117, 234, 236, 315, 327
Fnu4HI GCNGC 3 cut(s) 35, 38, 47
FokI GGATG 1 cut(s) 345
Fsp4HI GCNGC 3 cut(s) 35, 38, 47
FspBI CTAG 2 cut(s) 168, 302
GluI GCNGC 3 cut(s) 35, 38, 47
HincII GTYRAC 2 cut(s) 157, 352
HindII GTYRAC 2 cut(s) 157, 352
HpaI GTTAAC 1 cut(s) 157
HphI GGTGA 1 cut(s) 276
Hpy166II GTNNAC 2 cut(s) 157, 352
Hpy188I TCNGA 2 cut(s) 15, 209
Hpy188III TCNNGA 2 cut(s) 110, 224
Hpy8I GTNNAC 2 cut(s) 157, 352
HpyAV CCTTC 1 cut(s) 191
HpyCH4III ACNGT 1 cut(s) 71
HpyCH4V TGCA 3 cut(s) 37, 313, 336
HpyF10VI GCNNNNNNNGC 3 cut(s) 43, 46, 55
KspAI GTTAAC 1 cut(s) 157
Kzo9I GATC 1 cut(s) 250
LpnPI CCDG 4 cut(s) 123, 149, 237, 341
Lsp1109I GCAGC 3 cut(s) 21, 49, 58
LweI GCATC 1 cut(s) 323
MaeI CTAG 2 cut(s) 168, 302
MaeIII GTNAC 3 cut(s) 71, 261, 282
MalI GATC 1 cut(s) 252
MboI GATC 1 cut(s) 250
MboII GAAGA 3 cut(s) 15, 239, 249
MluCI AATT 5 cut(s) 9, 16, 136, 180, 201
MnlI CCTC 2 cut(s) 203, 252
MseI TTAA 1 cut(s) 156
MspA1I CMGCKG 1 cut(s) 34
MspR9I CCNGG 1 cut(s) 356
MvaI CCWGG 1 cut(s) 356
MwoI GCNNNNNNNGC 3 cut(s) 43, 46, 55
NdeII GATC 1 cut(s) 250
NlaIV GGNNCC 1 cut(s) 240
NmuCI GTSAC 1 cut(s) 282
PkrI GCNGC 3 cut(s) 36, 39, 48
PpuMI RGGWCCY 1 cut(s) 239
Psp5II RGGWCCY 1 cut(s) 239
Psp6I CCWGG 1 cut(s) 354
PspGI CCWGG 1 cut(s) 354
PspN4I GGNNCC 1 cut(s) 240
PspPI GGNCC 1 cut(s) 239
PspPPI RGGWCCY 1 cut(s) 239
PstI CTGCAG 1 cut(s) 39
SaqAI TTAA 1 cut(s) 156
SatI GCNGC 3 cut(s) 35, 38, 47
Sau3AI GATC 1 cut(s) 250
Sau96I GGNCC 1 cut(s) 239
ScrFI CCNGG 1 cut(s) 356
SetI ASST 2 cut(s) 165, 190
SfaNI GCATC 1 cut(s) 323
SfcI CTRYAG 2 cut(s) 35, 189
SinI GGWCC 1 cut(s) 239
Sse9I AATT 5 cut(s) 9, 16, 136, 180, 201
SsiI CCGC 2 cut(s) 32, 44
SspI AATATT 2 cut(s) 100, 127
SspMI CTAG 2 cut(s) 168, 302
StyD4I CCNGG 1 cut(s) 354
TaaI ACNGT 1 cut(s) 71
TasI AATT 5 cut(s) 9, 16, 136, 180, 201
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TseFI GTSAC 1 cut(s) 282
TseI GCWGC 3 cut(s) 34, 37, 46
Tsp45I GTSAC 1 cut(s) 282
TspDTI ATGAA 3 cut(s) 9, 210, 305
VpaK11BI GGWCC 1 cut(s) 239
XapI RAATTY 3 cut(s) 9, 16, 201
XspI CTAG 2 cut(s) 168, 302
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.