pycom02g04560

Alpha/beta hydrolase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
N/A
Physical Location & Seq
Forward (+)
2978409 .. 2978819
411 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 411 bp
ATGTCAGATATTACAGAAATCATCTCAGCCATAGAATCCAACTATCACAACTGGGCGGCCAACTTCGCCACACTTGCTGTGGACACAAATGACCCTCCCTCTGTCGAAAAATTCGCCAAGTGCCTGCAGAGAATGAGGCCTAAAGTTGCCCTCGCCTTGGCCAAAACCGTCTTTTACAGCGACCATAGAGACGTTATCGACAAGGTCTCGACTCCATGCACCATCGTCGGCACCAGCAACGACATTGCTGCTCCAAAATCGGTTGCGTTCTACATGCAGAAGAAGATGAAGGAAAACTCTAACGTCGAGATTATGAATACAAATGGGCATTTCCCACATTTGACTGCCCACCTTGAGCTTCTTGATGTGCTTGGAAAAGTCTTGGGCCTTAAATTTGATCATAATCCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_1 Abhydrolase_6

Protein Analysis

137

Amino Acids

15.11

Weight (kDa)

6.58

Isoelectric Point (pI)

33.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 230
AciI CCGC 1 cut(s) 56
AcoI YGGCCR 2 cut(s) 57, 159
AcsI RAATTY 2 cut(s) 110, 392
AfiI CCNNNNNNNGG 1 cut(s) 157
AluBI AGCT 1 cut(s) 358
AluI AGCT 1 cut(s) 358
Alw26I GTCTC 2 cut(s) 183, 211
AoxI GGCC 4 cut(s) 57, 137, 159, 385
ApeKI GCWGC 1 cut(s) 248
ApoI RAATTY 2 cut(s) 110, 392
AspS9I GGNCC 1 cut(s) 385
BalI TGGCCA 1 cut(s) 161
BanI GGYRCC 1 cut(s) 230
BbvI GCAGC 1 cut(s) 235
BccI CCATC 1 cut(s) 230
BcgI CGANNNNNNTGC 4 cut(s) 208, 230, 242, 264
BclI TGATCA 1 cut(s) 397
BcoDI GTCTC 2 cut(s) 183, 211
BfmI CTRYAG 1 cut(s) 125
BisI GCNGC 2 cut(s) 57, 249
BlsI GCNGC 2 cut(s) 58, 250
BmgT120I GGNCC 1 cut(s) 385
BmiI GGNNCC 1 cut(s) 232
BmrI ACTGGG 1 cut(s) 61
BmuI ACTGGG 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 374
BsaBI GATNNNNATC 1 cut(s) 402
BsaI GGTCTC 1 cut(s) 211
BsaJI CCNNGG 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 157
Bse1I ACTGG 1 cut(s) 56
Bse3DI GCAATG 1 cut(s) 243
Bse8I GATNNNNATC 1 cut(s) 402
BseDI CCNNGG 1 cut(s) 156
BseJI GATNNNNATC 1 cut(s) 402
BseLI CCNNNNNNNGG 1 cut(s) 157
BseMI GCAATG 1 cut(s) 243
BseMII CTCAG 1 cut(s) 39
BseNI ACTGG 1 cut(s) 56
BseXI GCAGC 1 cut(s) 235
BshFI GGCC 4 cut(s) 59, 139, 161, 387
BshNI GGYRCC 1 cut(s) 230
BslI CCNNNNNNNGG 1 cut(s) 157
BsmAI GTCTC 2 cut(s) 183, 211
BsmBI CGTCTC 1 cut(s) 183
BsnI GGCC 4 cut(s) 59, 139, 161, 387
Bso31I GGTCTC 1 cut(s) 211
Bsp143I GATC 1 cut(s) 397
BspACI CCGC 1 cut(s) 56
BspANI GGCC 4 cut(s) 59, 139, 161, 387
BspCNI CTCAG 1 cut(s) 38
BspLI GGNNCC 1 cut(s) 232
BspMAI CTGCAG 1 cut(s) 129
BspT107I GGYRCC 1 cut(s) 230
BspTNI GGTCTC 1 cut(s) 211
BsrDI GCAATG 1 cut(s) 243
BsrI ACTGG 1 cut(s) 56
BssECI CCNNGG 1 cut(s) 156
BssMI GATC 1 cut(s) 397
BssT1I CCWWGG 1 cut(s) 156
Bst4CI ACNGT 1 cut(s) 169
BstC8I GCNNGC 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 25
BstKTI GATC 1 cut(s) 400
BstMAI GTCTC 2 cut(s) 183, 211
BstMBI GATC 1 cut(s) 397
BstMWI GCNNNNNNNGC 2 cut(s) 65, 74
BstNSI RCATGY 1 cut(s) 277
BstSFI CTRYAG 1 cut(s) 125
BstV1I GCAGC 1 cut(s) 235
BsuRI GGCC 4 cut(s) 59, 139, 161, 387
Cac8I GCNNGC 1 cut(s) 125
Cfr13I GGNCC 1 cut(s) 385
CviAII CATG 2 cut(s) 216, 274
CviJI RGCY 6 cut(s) 29, 59, 139, 161, 358, 387
CviKI_1 RGCY 6 cut(s) 29, 59, 139, 161, 358, 387
DdeI CTNAG 1 cut(s) 25
DpnI GATC 1 cut(s) 399
DpnII GATC 1 cut(s) 397
EaeI YGGCCR 2 cut(s) 57, 159
Eco130I CCWWGG 1 cut(s) 156
Eco147I AGGCCT 1 cut(s) 139
Eco31I GGTCTC 1 cut(s) 211
EcoT14I CCWWGG 1 cut(s) 156
ErhI CCWWGG 1 cut(s) 156
Esp3I CGTCTC 1 cut(s) 183
FaeI CATG 2 cut(s) 219, 277
FaiI YATR 6 cut(s) 32, 186, 217, 275, 314, 402
FatI CATG 2 cut(s) 215, 273
FbaI TGATCA 1 cut(s) 397
Fnu4HI GCNGC 2 cut(s) 57, 249
Fsp4HI GCNGC 2 cut(s) 57, 249
GluI GCNGC 2 cut(s) 57, 249
HaeIII GGCC 4 cut(s) 59, 139, 161, 387
Hin1II CATG 2 cut(s) 219, 277
HinfI GANTC 2 cut(s) 35, 211
Hpy166II GTNNAC 1 cut(s) 82
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 3 cut(s) 208, 307, 362
Hpy8I GTNNAC 1 cut(s) 82
Hpy99I CGWCG 2 cut(s) 230, 308
HpyAV CCTTC 1 cut(s) 283
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4IV ACGT 2 cut(s) 192, 303
HpyCH4V TGCA 3 cut(s) 127, 219, 277
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 74
HpyF3I CTNAG 1 cut(s) 25
HpySE526I ACGT 2 cut(s) 192, 303
Hsp92II CATG 2 cut(s) 219, 277
Ksp22I TGATCA 1 cut(s) 397
Kzo9I GATC 1 cut(s) 397
LmnI GCTCC 1 cut(s) 256
LpnPI CCDG 3 cut(s) 37, 137, 247
Lsp1109I GCAGC 1 cut(s) 235
MaeII ACGT 2 cut(s) 192, 303
MalI GATC 1 cut(s) 399
MboI GATC 1 cut(s) 397
MboII GAAGA 2 cut(s) 292, 295
MlsI TGGCCA 1 cut(s) 161
MluCI AATT 2 cut(s) 110, 392
MluNI TGGCCA 1 cut(s) 161
MlyI GAGTC 1 cut(s) 205
MmeI TCCRAC 1 cut(s) 63
MnlI CCTC 4 cut(s) 105, 109, 129, 161
Mox20I TGGCCA 1 cut(s) 161
MscI TGGCCA 1 cut(s) 161
MseI TTAA 2 cut(s) 390, 409
Msp20I TGGCCA 1 cut(s) 161
MwoI GCNNNNNNNGC 2 cut(s) 65, 74
NdeII GATC 1 cut(s) 397
NlaIII CATG 2 cut(s) 219, 277
NlaIV GGNNCC 1 cut(s) 232
NspI RCATGY 1 cut(s) 277
PceI AGGCCT 1 cut(s) 139
PfeI GAWTC 1 cut(s) 35
PflFI GACNNNGTC 1 cut(s) 203
PkrI GCNGC 2 cut(s) 58, 250
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
PspN4I GGNNCC 1 cut(s) 232
PspPI GGNCC 1 cut(s) 385
PstI CTGCAG 1 cut(s) 129
PsyI GACNNNGTC 1 cut(s) 203
SaqAI TTAA 2 cut(s) 390, 409
SatI GCNGC 2 cut(s) 57, 249
Sau3AI GATC 1 cut(s) 397
Sau96I GGNCC 1 cut(s) 385
SchI GAGTC 1 cut(s) 205
SetI ASST 5 cut(s) 195, 207, 306, 354, 360
SfcI CTRYAG 1 cut(s) 125
SmlI CTYRAG 1 cut(s) 353
SmoI CTYRAG 1 cut(s) 353
Sse9I AATT 2 cut(s) 110, 392
SseBI AGGCCT 1 cut(s) 139
SsiI CCGC 1 cut(s) 56
StuI AGGCCT 1 cut(s) 139
StyI CCWWGG 1 cut(s) 156
TaaI ACNGT 1 cut(s) 169
TaiI ACGT 2 cut(s) 195, 306
TaqI TCGA 4 cut(s) 105, 198, 209, 306
TasI AATT 2 cut(s) 110, 392
TauI GCSGC 1 cut(s) 59
TfiI GAWTC 1 cut(s) 35
Tru1I TTAA 2 cut(s) 390, 409
Tru9I TTAA 2 cut(s) 390, 409
TseI GCWGC 1 cut(s) 248
TspDTI ATGAA 2 cut(s) 302, 329
Tth111I GACNNNGTC 1 cut(s) 203
XapI RAATTY 2 cut(s) 110, 392
XceI RCATGY 1 cut(s) 277
XcmI CCANNNNNNNNNTGG 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.