pycom02g21190
HSP70 Family

Heat shock 70 kDa protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
N/A
Physical Location & Seq
Reverse (-)
19371464 .. 19371914
451 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g21190.3

Sequence Viewer

Length: 291 bp
ATGCATCACGGAATTTGTCTTCACCCATTAAAGCAAGTCTGCATTTCTCTTTTATTAGTTTGTTTTGTATATTATGCCGTGAATTCTTTCGTATACCAGTTTGAAACATCCGAGGAATTTGAAAAAATTTCAACTAGCGAGGAACGCCAATCCTTTATTGGAAAGCTAGATGAGGTGCAAGAGTGGCTTTACACCGATGGTGAAGATGCTACTGCTTCAGAGTTTCAGGAACGCCTAGAGATGCTAAAAGCTATTGGTGATCCAATATTCTTCAGGTATATTCCAGTTTAG

Protein Analysis

97

Amino Acids

11.25

Weight (kDa)

4.58

Isoelectric Point (pI)

38.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 93
AclWI GGATC 1 cut(s) 254
AcsI RAATTY 4 cut(s) 12, 82, 116, 126
AcuI CTGAAG 2 cut(s) 201, 256
AgsI TTSAA 3 cut(s) 104, 122, 132
AluBI AGCT 2 cut(s) 166, 251
AluI AGCT 2 cut(s) 166, 251
AlwI GGATC 1 cut(s) 254
ApoI RAATTY 4 cut(s) 12, 82, 116, 126
Asp700I GAANNNNTTC 1 cut(s) 86
AsuHPI GGTGA 3 cut(s) 14, 212, 269
BbsI GAAGAC 1 cut(s) 11
BccI CCATC 1 cut(s) 191
BceAI ACGGC 1 cut(s) 62
BfaI CTAG 3 cut(s) 135, 167, 236
BmsI GCATC 3 cut(s) 13, 196, 231
BpiI GAAGAC 1 cut(s) 11
BsaJI CCNNGG 1 cut(s) 111
Bse1I ACTGG 2 cut(s) 97, 284
BseDI CCNNGG 1 cut(s) 111
BseGI GGATG 1 cut(s) 107
BseNI ACTGG 2 cut(s) 97, 284
Bsp143I GATC 1 cut(s) 259
BspPI GGATC 1 cut(s) 254
BsrI ACTGG 2 cut(s) 97, 284
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 1 cut(s) 259
BssNAI GTATAC 1 cut(s) 94
Bst1107I GTATAC 1 cut(s) 94
BstF5I GGATG 1 cut(s) 107
BstKTI GATC 1 cut(s) 262
BstMBI GATC 1 cut(s) 259
BstMWI GCNNNNNNNGC 2 cut(s) 144, 184
BstV2I GAAGAC 1 cut(s) 11
BstZ17I GTATAC 1 cut(s) 94
BtsCI GGATG 1 cut(s) 107
CviJI RGCY 3 cut(s) 166, 187, 251
CviKI_1 RGCY 3 cut(s) 166, 187, 251
DpnI GATC 1 cut(s) 261
DpnII GATC 1 cut(s) 259
Eco57I CTGAAG 2 cut(s) 201, 256
EcoRI GAATTC 1 cut(s) 82
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 4 cut(s) 70, 75, 94, 279
FalI AAGNNNNNCTT 2 cut(s) 171, 203
FblI GTMKAC 1 cut(s) 93
FokI GGATG 1 cut(s) 94
FspBI CTAG 3 cut(s) 135, 167, 236
HphI GGTGA 3 cut(s) 14, 212, 269
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 112, 220
Hpy188III TCNNGA 1 cut(s) 227
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4V TGCA 3 cut(s) 4, 42, 178
HpyF10VI GCNNNNNNNGC 2 cut(s) 144, 184
Kzo9I GATC 1 cut(s) 259
LpnPI CCDG 3 cut(s) 110, 212, 259
LweI GCATC 3 cut(s) 13, 196, 231
MaeI CTAG 3 cut(s) 135, 167, 236
MalI GATC 1 cut(s) 261
MboI GATC 1 cut(s) 259
MboII GAAGA 3 cut(s) 11, 215, 262
MluCI AATT 4 cut(s) 12, 82, 116, 126
MnlI CCTC 3 cut(s) 106, 133, 166
Mph1103I ATGCAT 1 cut(s) 6
MroXI GAANNNNTTC 1 cut(s) 86
MseI TTAA 1 cut(s) 29
MwoI GCNNNNNNNGC 2 cut(s) 144, 184
NdeII GATC 1 cut(s) 259
NsiI ATGCAT 1 cut(s) 6
PdmI GAANNNNTTC 1 cut(s) 86
SaqAI TTAA 1 cut(s) 29
Sau3AI GATC 1 cut(s) 259
SetI ASST 4 cut(s) 168, 177, 253, 278
SfaNI GCATC 3 cut(s) 13, 196, 231
Sse9I AATT 4 cut(s) 12, 82, 116, 126
SspI AATATT 1 cut(s) 267
SspMI CTAG 3 cut(s) 135, 167, 236
TasI AATT 4 cut(s) 12, 82, 116, 126
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TspGWI ACGGA 1 cut(s) 24
XapI RAATTY 4 cut(s) 12, 82, 116, 126
XcmI CCANNNNNNNNNTGG 1 cut(s) 155
XmiI GTMKAC 1 cut(s) 93
XmnI GAANNNNTTC 1 cut(s) 86
XspI CTAG 3 cut(s) 135, 167, 236
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.