pycom02g22830
BZIP Family

ABSCISIC ACID-INSENSITIVE 5-like protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr2
N/A
Physical Location & Seq
Forward (+)
20997991 .. 20998292
302 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom02g22830.2

Sequence Viewer

Length: 252 bp
ATGGTATCGCTTAAATTGGTGAATGGGGATACAGACAATGGGATCGATCAAGGTGGGGCTGATGGTAATTGCAAACAGTCACAGTTCCAGCCTTTGCCACGGCAAAACTCAATTTACAGTCTTACCTTGGACGAGGTACAGAATGAGTTAGGTGACTTGGGGAAGCCACTCAGCAGCATGAACCTTGACGAGCTTCTAAAAAATGTATGGAGTGCTGAAGCTAATCAGATCGATCATGGGTATAGACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.14

Weight (kDa)

4.5

Isoelectric Point (pI)

11.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 50
AcuI CTGAAG 1 cut(s) 237
AfaI GTAC 1 cut(s) 138
AluBI AGCT 2 cut(s) 193, 221
AluI AGCT 2 cut(s) 193, 221
AlwI GGATC 1 cut(s) 50
ApeKI GCWGC 1 cut(s) 174
AsuHPI GGTGA 2 cut(s) 31, 164
BbvI GCAGC 1 cut(s) 186
BccI CCATC 1 cut(s) 56
BceAI ACGGC 1 cut(s) 116
BciVI GTATCC 1 cut(s) 22
BfuI GTATCC 1 cut(s) 22
BisI GCNGC 1 cut(s) 175
BlsI GCNGC 1 cut(s) 176
Bsa29I ATCGAT 2 cut(s) 45, 231
BsaJI CCNNGG 2 cut(s) 98, 126
BseCI ATCGAT 2 cut(s) 45, 231
BseDI CCNNGG 2 cut(s) 98, 126
BseMII CTCAG 1 cut(s) 184
BseXI GCAGC 1 cut(s) 186
BshVI ATCGAT 2 cut(s) 45, 231
Bsp143I GATC 4 cut(s) 42, 46, 228, 232
BspCNI CTCAG 1 cut(s) 183
BspDI ATCGAT 2 cut(s) 45, 231
BspPI GGATC 1 cut(s) 50
BssECI CCNNGG 2 cut(s) 98, 126
BssMI GATC 4 cut(s) 42, 46, 228, 232
BssT1I CCWWGG 1 cut(s) 126
Bst4CI ACNGT 3 cut(s) 78, 84, 119
BstDEI CTNAG 1 cut(s) 170
BstDSI CCRYGG 1 cut(s) 98
BstKTI GATC 4 cut(s) 45, 49, 231, 235
BstMBI GATC 4 cut(s) 42, 46, 228, 232
BstV1I GCAGC 1 cut(s) 186
Bsu15I ATCGAT 2 cut(s) 45, 231
BsuI GTATCC 1 cut(s) 22
BsuTUI ATCGAT 2 cut(s) 45, 231
BtgI CCRYGG 1 cut(s) 98
ClaI ATCGAT 2 cut(s) 45, 231
Csp6I GTAC 1 cut(s) 137
CviAII CATG 2 cut(s) 178, 236
CviJI RGCY 5 cut(s) 59, 91, 166, 193, 221
CviKI_1 RGCY 5 cut(s) 59, 91, 166, 193, 221
CviQI GTAC 1 cut(s) 137
DdeI CTNAG 1 cut(s) 170
DpnI GATC 4 cut(s) 44, 48, 230, 234
DpnII GATC 4 cut(s) 42, 46, 228, 232
Eco130I CCWWGG 1 cut(s) 126
Eco57I CTGAAG 1 cut(s) 237
EcoT14I CCWWGG 1 cut(s) 126
ErhI CCWWGG 1 cut(s) 126
FaeI CATG 2 cut(s) 181, 239
FaiI YATR 4 cut(s) 179, 208, 237, 243
FatI CATG 2 cut(s) 177, 235
Fnu4HI GCNGC 1 cut(s) 175
Fsp4HI GCNGC 1 cut(s) 175
GluI GCNGC 1 cut(s) 175
Hin1II CATG 2 cut(s) 181, 239
HphI GGTGA 2 cut(s) 31, 164
Hpy188I TCNGA 1 cut(s) 228
HpyCH4III ACNGT 3 cut(s) 78, 84, 119
HpyCH4V TGCA 1 cut(s) 72
HpyF3I CTNAG 1 cut(s) 170
Hsp92II CATG 2 cut(s) 181, 239
Kzo9I GATC 4 cut(s) 42, 46, 228, 232
LpnPI CCDG 1 cut(s) 101
Lsp1109I GCAGC 1 cut(s) 186
MaeIII GTNAC 2 cut(s) 78, 152
MalI GATC 4 cut(s) 44, 48, 230, 234
MboI GATC 4 cut(s) 42, 46, 228, 232
MluCI AATT 3 cut(s) 14, 67, 111
MnlI CCTC 1 cut(s) 127
MseI TTAA 1 cut(s) 12
NdeII GATC 4 cut(s) 42, 46, 228, 232
NlaIII CATG 2 cut(s) 181, 239
NmuCI GTSAC 2 cut(s) 78, 152
PkrI GCNGC 1 cut(s) 176
RsaI GTAC 1 cut(s) 138
RsaNI GTAC 1 cut(s) 137
SaqAI TTAA 1 cut(s) 12
SatI GCNGC 1 cut(s) 175
Sau3AI GATC 4 cut(s) 42, 46, 228, 232
SetI ASST 7 cut(s) 55, 128, 138, 154, 186, 195, 223
Sse9I AATT 3 cut(s) 14, 67, 111
StyI CCWWGG 1 cut(s) 126
TaaI ACNGT 3 cut(s) 78, 84, 119
TaqI TCGA 2 cut(s) 45, 231
TasI AATT 3 cut(s) 14, 67, 111
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TseFI GTSAC 2 cut(s) 78, 152
TseI GCWGC 1 cut(s) 174
Tsp45I GTSAC 2 cut(s) 78, 152
TspDTI ATGAA 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.