pycom03g07340

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
N/A
Physical Location & Seq
Reverse (-)
5867005 .. 5868479
1475 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 798 bp
ATGGAGCACGATCAGGATGATGAGGATGGGCATGTGATGGATAACATTCAAGAAAAGTTAGAACATATGAAAGAGGATTTGGATGATGCTGAAGCTCTTAACACTACACTTGCTATAAGGGAGCGCATGAGTAATGATGAATTACAGGAGGCTCGTAAGGATTTAATCAATGTATGTATGCTAAGGGGATGGGAATCAATAAGTCCTGCTGTTATTGGAGTGAAGAGAATGAGTGATCTGGATTGCGAACCATTTCAAACTGCATGCAGGAGAAAATATCCGACGGACGAAGCAGCAGATGACCAGGCAATCATTGGATGGGAATCAATAAGTCCTGCTGTTATTGGCGTGAAGAGAATGGGTGATCTGGATTGCGAACCATTTCAAACTGCATGCAAGAGAAAATATCCAACGGACGAAGCAGCAGATGACCAGGCAGCAATGCTGTGCTCTTTGTGGGAGGATTATCTTGCAGATTCAAGCTGGTATCCATTCAAGATGAGCATGGATCCTTCTGGAGTTGCGAAGGCAAGTATTTTAACTTGTAATGCACTATCAAGCATCCATAGAATACAATTGATTGTTGCTCCCATTACACCAGCTTGTACTTCTCATGAGTGCATGTGGTTTCACTTAAATAAGTTATCCATGTTATTGTTCCATATCCAGTTTTTGTTCAGGATATATCTAAGCGCAACCGGTCCCCTGAATTGGCATTTTCATATTTACTATGACCTTTCTTCTTCAAGGTTTAGGTTTAGTCCTGTGAATTTGCACCTTCATGTATGCCTCCTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

266

Amino Acids

30.32

Weight (kDa)

4.94

Isoelectric Point (pI)

65.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
XH PF03469 118 - 169 1.1e-15 XH domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 503, 516
AcsI RAATTY 1 cut(s) 769
AcuI CTGAAG 1 cut(s) 111
AfaI GTAC 1 cut(s) 607
AfiI CCNNNNNNNGG 1 cut(s) 711
AgeI ACCGGT 1 cut(s) 698
AgsI TTSAA 6 cut(s) 50, 257, 386, 480, 496, 747
AjnI CCWGG 2 cut(s) 303, 432
AjuI GAANNNNNNNTTGG 2 cut(s) 62, 94
AluBI AGCT 3 cut(s) 95, 483, 602
AluI AGCT 3 cut(s) 95, 483, 602
Alw21I GWGCWC 2 cut(s) 9, 452
AlwI GGATC 2 cut(s) 503, 516
ApeKI GCWGC 3 cut(s) 293, 422, 437
ApoI RAATTY 1 cut(s) 769
AsiGI ACCGGT 1 cut(s) 698
Asp700I GAANNNNTTC 2 cut(s) 252, 381
AspLEI GCGC 2 cut(s) 126, 695
AspS9I GGNCC 1 cut(s) 701
AsuHPI GGTGA 1 cut(s) 374
AvaII GGWCC 1 cut(s) 701
BamHI GGATCC 1 cut(s) 508
Bbv12I GWGCWC 2 cut(s) 9, 452
BbvI GCAGC 3 cut(s) 305, 434, 449
BccI CCATC 4 cut(s) 20, 31, 183, 312
BciT130I CCWGG 2 cut(s) 305, 434
BciVI GTATCC 1 cut(s) 498
BfmI CTRYAG 1 cut(s) 794
BfuI GTATCC 1 cut(s) 498
BisI GCNGC 3 cut(s) 294, 423, 438
BlsI GCNGC 3 cut(s) 295, 424, 439
Bme1390I CCNGG 2 cut(s) 305, 434
Bme18I GGWCC 1 cut(s) 701
BmgT120I GGNCC 1 cut(s) 701
BmiI GGNNCC 2 cut(s) 510, 703
BmrFI CCNGG 2 cut(s) 305, 434
BmsI GCATC 2 cut(s) 76, 570
BpmI CTGGAG 1 cut(s) 537
Bpu10I CCTNAGC 1 cut(s) 182
BsaBI GATNNNNATC 2 cut(s) 193, 322
BsaWI WCCGGW 1 cut(s) 698
Bsc4I CCNNNNNNNGG 1 cut(s) 711
Bse118I RCCGGY 1 cut(s) 698
Bse1I ACTGG 1 cut(s) 667
Bse3DI GCAATG 1 cut(s) 447
Bse8I GATNNNNATC 2 cut(s) 193, 322
BseBI CCWGG 2 cut(s) 305, 434
BseGI GGATG 6 cut(s) 22, 31, 88, 194, 323, 561
BseJI GATNNNNATC 2 cut(s) 193, 322
BseLI CCNNNNNNNGG 1 cut(s) 711
BseMI GCAATG 1 cut(s) 447
BseNI ACTGG 1 cut(s) 667
BseXI GCAGC 3 cut(s) 305, 434, 449
BshTI ACCGGT 1 cut(s) 698
BsiHKAI GWGCWC 2 cut(s) 9, 452
BsiSI CCGG 1 cut(s) 699
BslFI GGGAC 1 cut(s) 687
BslI CCNNNNNNNGG 1 cut(s) 711
BsmFI GGGAC 1 cut(s) 687
Bsp1286I GDGCHC 2 cut(s) 9, 452
Bsp143I GATC 4 cut(s) 10, 235, 364, 508
BspHI TCATGA 1 cut(s) 613
BspLI GGNNCC 2 cut(s) 510, 703
BspPI GGATC 2 cut(s) 503, 516
BsrDI GCAATG 1 cut(s) 447
BsrFI RCCGGY 1 cut(s) 698
BsrI ACTGG 1 cut(s) 667
BssAI RCCGGY 1 cut(s) 698
BssMI GATC 4 cut(s) 10, 235, 364, 508
Bst2UI CCWGG 2 cut(s) 305, 434
Bst6I CTCTTC 2 cut(s) 218, 347
BstC8I GCNNGC 2 cut(s) 265, 394
BstDEI CTNAG 2 cut(s) 182, 689
BstF5I GGATG 6 cut(s) 22, 31, 88, 194, 323, 561
BstHHI GCGC 2 cut(s) 126, 695
BstKTI GATC 4 cut(s) 13, 238, 367, 511
BstMBI GATC 4 cut(s) 10, 235, 364, 508
BstNI CCWGG 2 cut(s) 305, 434
BstNSI RCATGY 4 cut(s) 35, 267, 396, 625
BstSCI CCNGG 2 cut(s) 303, 432
BstSFI CTRYAG 1 cut(s) 794
BstV1I GCAGC 3 cut(s) 305, 434, 449
BstX2I RGATCY 1 cut(s) 508
BstYI RGATCY 1 cut(s) 508
BsuI GTATCC 1 cut(s) 498
BtsCI GGATG 6 cut(s) 22, 31, 88, 194, 323, 561
Cac8I GCNNGC 2 cut(s) 265, 394
CciI TCATGA 1 cut(s) 613
CfoI GCGC 2 cut(s) 126, 695
Cfr10I RCCGGY 1 cut(s) 698
Cfr13I GGNCC 1 cut(s) 701
Csp6I GTAC 1 cut(s) 606
CspAI ACCGGT 1 cut(s) 698
CviAII CATG 9 cut(s) 32, 127, 264, 393, 505, 614, 622, 649, 782
CviJI RGCY 4 cut(s) 95, 152, 483, 602
CviKI_1 RGCY 4 cut(s) 95, 152, 483, 602
CviQI GTAC 1 cut(s) 606
DdeI CTNAG 2 cut(s) 182, 689
DpnI GATC 4 cut(s) 12, 237, 366, 510
DpnII GATC 4 cut(s) 10, 235, 364, 508
Eam1104I CTCTTC 2 cut(s) 218, 347
EarI CTCTTC 2 cut(s) 218, 347
Eco47I GGWCC 1 cut(s) 701
Eco57I CTGAAG 1 cut(s) 111
EcoRII CCWGG 2 cut(s) 303, 432
FaeI CATG 9 cut(s) 35, 130, 267, 396, 508, 617, 625, 652, 785
FaqI GGGAC 1 cut(s) 687
FatI CATG 9 cut(s) 31, 126, 263, 392, 504, 613, 621, 648, 781
FauNDI CATATG 1 cut(s) 66
Fnu4HI GCNGC 3 cut(s) 294, 423, 438
FokI GGATG 6 cut(s) 29, 38, 95, 201, 330, 548
Fsp4HI GCNGC 3 cut(s) 294, 423, 438
GlaI GCGC 2 cut(s) 125, 694
GluI GCNGC 3 cut(s) 294, 423, 438
GsuI CTGGAG 1 cut(s) 537
HapII CCGG 1 cut(s) 699
HhaI GCGC 2 cut(s) 126, 695
Hin1II CATG 9 cut(s) 35, 130, 267, 396, 508, 617, 625, 652, 785
Hin6I GCGC 2 cut(s) 124, 693
HinP1I GCGC 2 cut(s) 124, 693
HinfI GANTC 3 cut(s) 194, 323, 476
HpaII CCGG 1 cut(s) 699
HphI GGTGA 1 cut(s) 374
Hpy188I TCNGA 1 cut(s) 282
Hpy188III TCNNGA 8 cut(s) 14, 50, 239, 368, 496, 516, 614, 679
Hpy99I CGWCG 1 cut(s) 286
HpyAV CCTTC 3 cut(s) 520, 522, 788
HpyCH4V TGCA 8 cut(s) 263, 267, 392, 396, 473, 551, 621, 775
HpyF3I CTNAG 2 cut(s) 182, 689
Hsp92II CATG 9 cut(s) 35, 130, 267, 396, 508, 617, 625, 652, 785
HspAI GCGC 2 cut(s) 124, 693
Kzo9I GATC 4 cut(s) 10, 235, 364, 508
LmnI GCTCC 3 cut(s) 4, 121, 592
Lsp1109I GCAGC 3 cut(s) 305, 434, 449
LweI GCATC 2 cut(s) 76, 570
MalI GATC 4 cut(s) 12, 237, 366, 510
MboI GATC 4 cut(s) 10, 235, 364, 508
MboII GAAGA 4 cut(s) 235, 364, 732, 735
MfeI CAATTG 1 cut(s) 575
MflI RGATCY 1 cut(s) 508
MhlI GDGCHC 2 cut(s) 9, 452
MluCI AATT 4 cut(s) 140, 575, 709, 769
MmeI TCCRAC 2 cut(s) 305, 434
MnlI CCTC 4 cut(s) 16, 67, 142, 454
MroXI GAANNNNTTC 2 cut(s) 252, 381
MseI TTAA 4 cut(s) 99, 164, 539, 635
MslI CAYNNNNRTG 1 cut(s) 780
MspI CCGG 1 cut(s) 699
MspR9I CCNGG 2 cut(s) 305, 434
MunI CAATTG 1 cut(s) 575
MvaI CCWGG 2 cut(s) 305, 434
NdeI CATATG 1 cut(s) 66
NdeII GATC 4 cut(s) 10, 235, 364, 508
NlaIII CATG 9 cut(s) 35, 130, 267, 396, 508, 617, 625, 652, 785
NlaIV GGNNCC 2 cut(s) 510, 703
NspI RCATGY 4 cut(s) 35, 267, 396, 625
PaeI GCATGC 2 cut(s) 267, 396
PagI TCATGA 1 cut(s) 613
PdmI GAANNNNTTC 2 cut(s) 252, 381
PfeI GAWTC 3 cut(s) 194, 323, 476
PinAI ACCGGT 1 cut(s) 698
PkrI GCNGC 3 cut(s) 295, 424, 439
Psp6I CCWGG 2 cut(s) 303, 432
PspGI CCWGG 2 cut(s) 303, 432
PspN4I GGNNCC 2 cut(s) 510, 703
PspPI GGNCC 1 cut(s) 701
PsuI RGATCY 1 cut(s) 508
RsaI GTAC 1 cut(s) 607
RsaNI GTAC 1 cut(s) 606
RseI CAYNNNNRTG 1 cut(s) 780
SaqAI TTAA 4 cut(s) 99, 164, 539, 635
SatI GCNGC 3 cut(s) 294, 423, 438
Sau3AI GATC 4 cut(s) 10, 235, 364, 508
Sau96I GGNCC 1 cut(s) 701
ScrFI CCNGG 2 cut(s) 305, 434
SduI GDGCHC 2 cut(s) 9, 452
SetI ASST 7 cut(s) 97, 485, 604, 738, 752, 758, 780
SfaNI GCATC 2 cut(s) 76, 570
SfcI CTRYAG 1 cut(s) 794
SinI GGWCC 1 cut(s) 701
SmiMI CAYNNNNRTG 1 cut(s) 780
SphI GCATGC 2 cut(s) 267, 396
Sse9I AATT 4 cut(s) 140, 575, 709, 769
StyD4I CCNGG 2 cut(s) 303, 432
TasI AATT 4 cut(s) 140, 575, 709, 769
TatI WGTACW 1 cut(s) 605
TfiI GAWTC 3 cut(s) 194, 323, 476
Tru1I TTAA 4 cut(s) 99, 164, 539, 635
Tru9I TTAA 4 cut(s) 99, 164, 539, 635
TseI GCWGC 3 cut(s) 293, 422, 437
TspDTI ATGAA 4 cut(s) 83, 153, 710, 770
TspGWI ACGGA 2 cut(s) 299, 428
VpaK11BI GGWCC 1 cut(s) 701
XapI RAATTY 1 cut(s) 769
XceI RCATGY 4 cut(s) 35, 267, 396, 625
XcmI CCANNNNNNNNNTGG 1 cut(s) 311
XmnI GAANNNNTTC 2 cut(s) 252, 381
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.