pycom03g12340
HSP70 Family

Belongs to the heat shock protein 70 family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
N/A
Physical Location & Seq
Reverse (-)
12823375 .. 12824545
1171 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g12340.2

Sequence Viewer

Length: 300 bp
ATGCACCAGGTTCAATTCACTGTAACTCGTTTTCGCCCCCGAGAAATCAAATTTGAATTCTTTTATCCTCATGATGACGTAGTCATGCATTCCTCCAGCACCAAGGGGCCTGCCTCGATCGAAGTCACGTTTGATATTGAGGCCAATGGTATTGTCACTAATTCAGCCAAGGACAAGGTCACCAACAAAGAGAAGAAGATTACTCTCCGCTCATCTGGAGGTCTTACCGACAGGGAGATTGAAAAGATGGTCAGGGAAGCAGAGCTGCATGCTCAGAGGGACAAGAGAGGAAAGCATTGA
Functional Annotation

Protein Analysis

100

Amino Acids

11.42

Weight (kDa)

9.34

Isoelectric Point (pI)

52.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 210
AciI CCGC 1 cut(s) 208
AcsI RAATTY 2 cut(s) 50, 56
AgsI TTSAA 3 cut(s) 14, 56, 242
AjnI CCWGG 1 cut(s) 6
AluBI AGCT 1 cut(s) 265
AluI AGCT 1 cut(s) 265
Ama87I CYCGRG 1 cut(s) 39
AoxI GGCC 2 cut(s) 107, 141
ApeKI GCWGC 1 cut(s) 265
ApoI RAATTY 2 cut(s) 50, 56
AspS9I GGNCC 1 cut(s) 107
AsuHPI GGTGA 1 cut(s) 172
AvaI CYCGRG 1 cut(s) 39
BbvI GCAGC 1 cut(s) 252
BccI CCATC 1 cut(s) 241
BciT130I CCWGG 1 cut(s) 8
BisI GCNGC 1 cut(s) 266
BlsI GCNGC 1 cut(s) 267
Bme1390I CCNGG 1 cut(s) 8
BmeT110I CYCGRG 1 cut(s) 39
BmgT120I GGNCC 1 cut(s) 107
BmiI GGNNCC 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 8
BpmI CTGGAG 2 cut(s) 79, 237
BsaJI CCNNGG 2 cut(s) 102, 168
BseBI CCWGG 1 cut(s) 8
BseDI CCNNGG 2 cut(s) 102, 168
BseMII CTCAG 1 cut(s) 287
BseXI GCAGC 1 cut(s) 252
Bsh1285I CGRYCG 1 cut(s) 120
BshFI GGCC 2 cut(s) 109, 143
BsiEI CGRYCG 1 cut(s) 120
BsiHKCI CYCGRG 1 cut(s) 39
BslFI GGGAC 1 cut(s) 293
BsmFI GGGAC 1 cut(s) 293
BsmI GAATGC 1 cut(s) 88
BsnI GGCC 2 cut(s) 109, 143
BsoBI CYCGRG 1 cut(s) 39
Bsp143I GATC 1 cut(s) 117
BspACI CCGC 1 cut(s) 208
BspANI GGCC 2 cut(s) 109, 143
BspCNI CTCAG 1 cut(s) 286
BspHI TCATGA 1 cut(s) 70
BspLI GGNNCC 1 cut(s) 108
BsrBI CCGCTC 1 cut(s) 210
BssECI CCNNGG 2 cut(s) 102, 168
BssMI GATC 1 cut(s) 117
BssT1I CCWWGG 2 cut(s) 102, 168
Bst2UI CCWGG 1 cut(s) 8
Bst4CI ACNGT 1 cut(s) 22
BstC8I GCNNGC 2 cut(s) 111, 270
BstDEI CTNAG 1 cut(s) 273
BstEII GGTNACC 1 cut(s) 178
BstKTI GATC 1 cut(s) 120
BstMBI GATC 1 cut(s) 117
BstMCI CGRYCG 1 cut(s) 120
BstNI CCWGG 1 cut(s) 8
BstNSI RCATGY 1 cut(s) 272
BstPI GGTNACC 1 cut(s) 178
BstSCI CCNGG 1 cut(s) 6
BstV1I GCAGC 1 cut(s) 252
BsuRI GGCC 2 cut(s) 109, 143
BtsIMutI CAGTG 1 cut(s) 18
Cac8I GCNNGC 2 cut(s) 111, 270
CciI TCATGA 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 107
CsiI ACCWGGT 1 cut(s) 6
CviAII CATG 3 cut(s) 71, 85, 269
CviJI RGCY 4 cut(s) 109, 143, 167, 265
CviKI_1 RGCY 4 cut(s) 109, 143, 167, 265
DdeI CTNAG 1 cut(s) 273
DpnI GATC 1 cut(s) 119
DpnII GATC 1 cut(s) 117
Eco130I CCWWGG 2 cut(s) 102, 168
Eco88I CYCGRG 1 cut(s) 39
Eco91I GGTNACC 1 cut(s) 178
EcoO109I RGGNCCY 1 cut(s) 107
EcoO65I GGTNACC 1 cut(s) 178
EcoRI GAATTC 1 cut(s) 56
EcoRII CCWGG 1 cut(s) 6
EcoT14I CCWWGG 2 cut(s) 102, 168
EcoT22I ATGCAT 1 cut(s) 90
ErhI CCWWGG 2 cut(s) 102, 168
FaeI CATG 3 cut(s) 74, 88, 272
FaiI YATR 3 cut(s) 72, 86, 270
FaqI GGGAC 1 cut(s) 293
FatI CATG 3 cut(s) 70, 84, 268
Fnu4HI GCNGC 1 cut(s) 266
Fsp4HI GCNGC 1 cut(s) 266
GluI GCNGC 1 cut(s) 266
GsuI CTGGAG 2 cut(s) 79, 237
HaeIII GGCC 2 cut(s) 109, 143
Hin1II CATG 3 cut(s) 74, 88, 272
HphI GGTGA 1 cut(s) 172
Hpy188I TCNGA 1 cut(s) 276
Hpy188III TCNNGA 2 cut(s) 71, 216
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4IV ACGT 2 cut(s) 78, 128
HpyCH4V TGCA 3 cut(s) 4, 88, 268
HpyF3I CTNAG 1 cut(s) 273
HpySE526I ACGT 2 cut(s) 78, 128
Hsp92II CATG 3 cut(s) 74, 88, 272
Kzo9I GATC 1 cut(s) 117
LpnPI CCDG 6 cut(s) 20, 109, 123, 201, 217, 238
Lsp1109I GCAGC 1 cut(s) 252
MabI ACCWGGT 1 cut(s) 6
MaeII ACGT 2 cut(s) 78, 128
MaeIII GTNAC 4 cut(s) 22, 124, 154, 178
MalI GATC 1 cut(s) 119
MbiI CCGCTC 1 cut(s) 210
MboI GATC 1 cut(s) 117
MboII GAAGA 2 cut(s) 205, 208
MluCI AATT 4 cut(s) 14, 50, 56, 160
MnlI CCTC 7 cut(s) 78, 103, 124, 133, 212, 270, 281
Mph1103I ATGCAT 1 cut(s) 90
MspR9I CCNGG 1 cut(s) 8
Mva1269I GAATGC 1 cut(s) 88
MvaI CCWGG 1 cut(s) 8
NdeII GATC 1 cut(s) 117
NlaIII CATG 3 cut(s) 74, 88, 272
NlaIV GGNNCC 1 cut(s) 108
NmuCI GTSAC 3 cut(s) 124, 154, 178
NsiI ATGCAT 1 cut(s) 90
NspI RCATGY 1 cut(s) 272
PaeI GCATGC 1 cut(s) 272
PagI TCATGA 1 cut(s) 70
PctI GAATGC 1 cut(s) 88
PflFI GACNNNGTC 2 cut(s) 80, 176
PkrI GCNGC 1 cut(s) 267
Ple19I CGATCG 1 cut(s) 120
Psp6I CCWGG 1 cut(s) 6
PspEI GGTNACC 1 cut(s) 178
PspGI CCWGG 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 108
PspPI GGNCC 1 cut(s) 107
PsyI GACNNNGTC 2 cut(s) 80, 176
PvuI CGATCG 1 cut(s) 120
SatI GCNGC 1 cut(s) 266
Sau3AI GATC 1 cut(s) 117
Sau96I GGNCC 1 cut(s) 107
ScrFI CCNGG 1 cut(s) 8
SetI ASST 6 cut(s) 12, 81, 131, 180, 223, 267
SexAI ACCWGGT 1 cut(s) 6
SphI GCATGC 1 cut(s) 272
Sse9I AATT 4 cut(s) 14, 50, 56, 160
SsiI CCGC 1 cut(s) 208
StyD4I CCNGG 1 cut(s) 6
StyI CCWWGG 2 cut(s) 102, 168
TaaI ACNGT 1 cut(s) 22
TaiI ACGT 2 cut(s) 81, 131
TaqI TCGA 2 cut(s) 116, 120
TasI AATT 4 cut(s) 14, 50, 56, 160
TscAI CASTG 1 cut(s) 25
TseFI GTSAC 3 cut(s) 124, 154, 178
TseI GCWGC 1 cut(s) 265
Tsp45I GTSAC 3 cut(s) 124, 154, 178
TspRI CASTG 1 cut(s) 25
Tth111I GACNNNGTC 2 cut(s) 80, 176
XapI RAATTY 2 cut(s) 50, 56
XceI RCATGY 1 cut(s) 272
Zsp2I ATGCAT 1 cut(s) 90
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.