pycom03g17710

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
N/A
Physical Location & Seq
Forward (+)
18822496 .. 18824128
1633 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 264 bp
ATGGACTACCCCTATGAGTACATAGTTCACAACATGAAATATCCCAGCATTGCTGCATTTTGGCTGTTTACCTTGCCTCAGGTTGTGGGGGGATTCGACTTCGATGATGATGTCAAGAAAAAAATTTGGTGGCAATACAAGGAATCTATGTGGTATGATCAACTTCGTGATGTGGTGGTCAAGCGAAAACCTGGCTGGGAGCAGTTGCACGAAACCTTGATCTCTATAGATCCTGTCGAGCCAAGGAAGATCCTGTTATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.61

Weight (kDa)

5.57

Isoelectric Point (pI)

39.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 224, 244
AcsI RAATTY 1 cut(s) 123
AfaI GTAC 1 cut(s) 20
AjnI CCWGG 1 cut(s) 190
AlwI GGATC 2 cut(s) 224, 244
ApeKI GCWGC 1 cut(s) 53
ApoI RAATTY 1 cut(s) 123
AxyI CCTNAGG 1 cut(s) 78
BbvI GCAGC 1 cut(s) 40
BciT130I CCWGG 1 cut(s) 192
BclI TGATCA 1 cut(s) 157
BfmI CTRYAG 1 cut(s) 225
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
Bme1390I CCNGG 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 192
BsaJI CCNNGG 1 cut(s) 242
Bse21I CCTNAGG 1 cut(s) 78
Bse3DI GCAATG 1 cut(s) 48
BseBI CCWGG 1 cut(s) 192
BseDI CCNNGG 1 cut(s) 242
BseMI GCAATG 1 cut(s) 48
BseMII CTCAG 1 cut(s) 92
BseXI GCAGC 1 cut(s) 40
BseYI CCCAGC 2 cut(s) 44, 195
Bsp143I GATC 4 cut(s) 157, 219, 229, 249
BspCNI CTCAG 1 cut(s) 91
BspPI GGATC 2 cut(s) 224, 244
BsrDI GCAATG 1 cut(s) 48
BssECI CCNNGG 1 cut(s) 242
BssMI GATC 4 cut(s) 157, 219, 229, 249
BssT1I CCWWGG 1 cut(s) 242
Bst2UI CCWGG 1 cut(s) 192
BstDEI CTNAG 1 cut(s) 78
BstKTI GATC 4 cut(s) 160, 222, 232, 252
BstMBI GATC 4 cut(s) 157, 219, 229, 249
BstNI CCWGG 1 cut(s) 192
BstSCI CCNGG 1 cut(s) 190
BstSFI CTRYAG 1 cut(s) 225
BstV1I GCAGC 1 cut(s) 40
BstX2I RGATCY 2 cut(s) 229, 249
BstYI RGATCY 2 cut(s) 229, 249
Bsu36I CCTNAGG 1 cut(s) 78
Csp6I GTAC 1 cut(s) 19
CviAII CATG 1 cut(s) 34
CviJI RGCY 3 cut(s) 64, 195, 241
CviKI_1 RGCY 3 cut(s) 64, 195, 241
CviQI GTAC 1 cut(s) 19
DdeI CTNAG 1 cut(s) 78
DpnI GATC 4 cut(s) 159, 221, 231, 251
DpnII GATC 4 cut(s) 157, 219, 229, 249
Eco130I CCWWGG 1 cut(s) 242
Eco81I CCTNAGG 1 cut(s) 78
EcoRII CCWGG 1 cut(s) 190
EcoT14I CCWWGG 1 cut(s) 242
ErhI CCWWGG 1 cut(s) 242
FaeI CATG 1 cut(s) 37
FaiI YATR 6 cut(s) 15, 23, 35, 149, 156, 227
FatI CATG 1 cut(s) 33
FbaI TGATCA 1 cut(s) 157
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
GluI GCNGC 1 cut(s) 54
GsaI CCCAGC 2 cut(s) 48, 199
Hin1II CATG 1 cut(s) 37
HinfI GANTC 2 cut(s) 93, 143
Hpy166II GTNNAC 2 cut(s) 28, 69
Hpy188III TCNNGA 2 cut(s) 115, 167
Hpy8I GTNNAC 2 cut(s) 28, 69
HpyCH4V TGCA 2 cut(s) 56, 208
HpyF3I CTNAG 1 cut(s) 78
Hsp92II CATG 1 cut(s) 37
Ksp22I TGATCA 1 cut(s) 157
Kzo9I GATC 4 cut(s) 157, 219, 229, 249
LmnI GCTCC 1 cut(s) 199
LpnPI CCDG 6 cut(s) 58, 65, 177, 181, 204, 246
Lsp1109I GCAGC 1 cut(s) 40
MalI GATC 4 cut(s) 159, 221, 231, 251
MboI GATC 4 cut(s) 157, 219, 229, 249
MboII GAAGA 1 cut(s) 259
MflI RGATCY 2 cut(s) 229, 249
MluCI AATT 1 cut(s) 123
MnlI CCTC 1 cut(s) 87
MspR9I CCNGG 1 cut(s) 192
MvaI CCWGG 1 cut(s) 192
NdeII GATC 4 cut(s) 157, 219, 229, 249
NlaIII CATG 1 cut(s) 37
PfeI GAWTC 2 cut(s) 93, 143
PkrI GCNGC 1 cut(s) 55
Psp6I CCWGG 1 cut(s) 190
PspFI CCCAGC 2 cut(s) 44, 195
PspGI CCWGG 1 cut(s) 190
PsuI RGATCY 2 cut(s) 229, 249
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 4 cut(s) 157, 219, 229, 249
ScrFI CCNGG 1 cut(s) 192
SetI ASST 4 cut(s) 74, 84, 193, 218
SfcI CTRYAG 1 cut(s) 225
Sse9I AATT 1 cut(s) 123
StyD4I CCNGG 1 cut(s) 190
StyI CCWWGG 1 cut(s) 242
TaqI TCGA 3 cut(s) 96, 102, 237
TasI AATT 1 cut(s) 123
TatI WGTACW 1 cut(s) 18
TfiI GAWTC 2 cut(s) 93, 143
TseI GCWGC 1 cut(s) 53
TspDTI ATGAA 1 cut(s) 50
XapI RAATTY 1 cut(s) 123
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.