pycom04g07770

Oxysterol-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
N/A
Physical Location & Seq
Forward (+)
8656566 .. 8658020
1455 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 477 bp
ATGCATTATGTTAATGGTGATGGGAGTGGCAAGTTAAATCCTTCAGATGCTTCATTGTTGTGGAAAAGTAGTAAACTTCCTAATGTCACACGATACAACTTAACGTCATTCGCAATGACACTGAATGAGCTAACACCTGGACTGCAGGAGAAGCTCCCACCCACCGATTCCAGGCTCAGACCGGACCAACGGCATCTAGAGAATGGAGAGTACGAAAAGGCAAATGAAGAGAAACAGCGACTGGAAAAAAGGCAAAGAATGTTGATTCGAGGAAACTACAAGAAAACGGGTGGAAACCCAGATGGTTCGAGAGAGAGGGTGAAGATGGACCATTCCGCTATGTTGGTGGTTATTGGGAAACAAGGAAGCAGGGAAAATGGGATGAATGCCCAGACATTTTTGGTGAATTTAACGAAGGCCTTGATGAGCAATCAGAAGGGTCATGAATATAATTCAGGAAACATAAATTGCCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Oxysterol_BP PH_11

Protein Analysis

159

Amino Acids

17.83

Weight (kDa)

9.6

Isoelectric Point (pI)

41.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Oxysterol_BP PF01237 12 - 91 4.8e-27 Oxysterol-binding protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 336
AcsI RAATTY 1 cut(s) 406
AcuI CTGAAG 1 cut(s) 27
AfaI GTAC 1 cut(s) 212
AfiI CCNNNNNNNGG 1 cut(s) 171
AjnI CCWGG 2 cut(s) 136, 170
AluBI AGCT 2 cut(s) 130, 154
AluI AGCT 2 cut(s) 130, 154
AlwNI CAGNNNCTG 1 cut(s) 241
AoxI GGCC 1 cut(s) 417
ApoI RAATTY 1 cut(s) 406
AspS9I GGNCC 2 cut(s) 184, 328
AsuHPI GGTGA 3 cut(s) 29, 331, 415
AvaII GGWCC 2 cut(s) 184, 328
BccI CCATC 3 cut(s) 14, 296, 319
BceAI ACGGC 1 cut(s) 206
BciT130I CCWGG 2 cut(s) 138, 172
BfaI CTAG 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 143
Bme1390I CCNGG 2 cut(s) 138, 172
Bme18I GGWCC 2 cut(s) 184, 328
BmgT120I GGNCC 2 cut(s) 184, 328
BmrFI CCNGG 2 cut(s) 138, 172
BmsI GCATC 2 cut(s) 37, 202
BsaWI WCCGGW 1 cut(s) 181
Bsc4I CCNNNNNNNGG 1 cut(s) 171
Bse1I ACTGG 1 cut(s) 246
Bse3DI GCAATG 1 cut(s) 120
BseBI CCWGG 2 cut(s) 138, 172
BseGI GGATG 1 cut(s) 387
BseLI CCNNNNNNNGG 1 cut(s) 171
BseMI GCAATG 1 cut(s) 120
BseMII CTCAG 1 cut(s) 190
BseNI ACTGG 1 cut(s) 246
BshFI GGCC 1 cut(s) 419
BsiSI CCGG 1 cut(s) 182
BslI CCNNNNNNNGG 1 cut(s) 171
BsmI GAATGC 1 cut(s) 391
BsnI GGCC 1 cut(s) 419
BspACI CCGC 1 cut(s) 336
BspANI GGCC 1 cut(s) 419
BspCNI CTCAG 1 cut(s) 189
BspHI TCATGA 1 cut(s) 442
BspMAI CTGCAG 1 cut(s) 147
BsrDI GCAATG 1 cut(s) 120
BsrI ACTGG 1 cut(s) 246
Bst2UI CCWGG 2 cut(s) 138, 172
Bst6I CTCTTC 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 176
BstF5I GGATG 1 cut(s) 387
BstMWI GCNNNNNNNGC 1 cut(s) 151
BstNI CCWGG 2 cut(s) 138, 172
BstSCI CCNGG 2 cut(s) 136, 170
BstSFI CTRYAG 1 cut(s) 143
BsuRI GGCC 1 cut(s) 419
BtsCI GGATG 1 cut(s) 387
BtsIMutI CAGTG 1 cut(s) 119
CaiI CAGNNNCTG 1 cut(s) 241
CciI TCATGA 1 cut(s) 442
Cfr13I GGNCC 2 cut(s) 184, 328
Csp6I GTAC 1 cut(s) 211
CviAII CATG 1 cut(s) 443
CviJI RGCY 4 cut(s) 130, 154, 175, 419
CviKI_1 RGCY 4 cut(s) 130, 154, 175, 419
CviQI GTAC 1 cut(s) 211
DdeI CTNAG 1 cut(s) 176
Eam1104I CTCTTC 1 cut(s) 222
EarI CTCTTC 1 cut(s) 222
Eco147I AGGCCT 1 cut(s) 419
Eco47I GGWCC 2 cut(s) 184, 328
Eco57I CTGAAG 1 cut(s) 27
EcoRII CCWGG 2 cut(s) 136, 170
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 446
FaiI YATR 5 cut(s) 9, 341, 444, 450, 464
FatI CATG 1 cut(s) 442
FokI GGATG 1 cut(s) 394
FspBI CTAG 1 cut(s) 197
HaeIII GGCC 1 cut(s) 419
HapII CCGG 1 cut(s) 182
Hin1II CATG 1 cut(s) 446
HinfI GANTC 2 cut(s) 167, 265
HpaII CCGG 1 cut(s) 182
HphI GGTGA 3 cut(s) 29, 331, 415
Hpy166II GTNNAC 1 cut(s) 74
Hpy188I TCNGA 3 cut(s) 46, 179, 435
Hpy188III TCNNGA 4 cut(s) 197, 309, 443, 456
Hpy8I GTNNAC 1 cut(s) 74
HpyAV CCTTC 3 cut(s) 51, 409, 430
HpyCH4IV ACGT 1 cut(s) 104
HpyCH4V TGCA 2 cut(s) 4, 145
HpyF10VI GCNNNNNNNGC 1 cut(s) 151
HpyF3I CTNAG 1 cut(s) 176
HpySE526I ACGT 1 cut(s) 104
Hsp92II CATG 1 cut(s) 446
LmnI GCTCC 1 cut(s) 159
LweI GCATC 2 cut(s) 37, 202
MaeI CTAG 1 cut(s) 197
MaeII ACGT 1 cut(s) 104
MaeIII GTNAC 1 cut(s) 85
MboII GAAGA 2 cut(s) 239, 334
MluCI AATT 3 cut(s) 406, 451, 466
MnlI CCTC 2 cut(s) 263, 309
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 4 cut(s) 12, 35, 101, 410
MslI CAYNNNNRTG 1 cut(s) 58
MspI CCGG 1 cut(s) 182
MspR9I CCNGG 2 cut(s) 138, 172
Mva1269I GAATGC 1 cut(s) 391
MvaI CCWGG 2 cut(s) 138, 172
MwoI GCNNNNNNNGC 1 cut(s) 151
NlaIII CATG 1 cut(s) 446
NmuCI GTSAC 1 cut(s) 85
NsiI ATGCAT 1 cut(s) 6
PagI TCATGA 1 cut(s) 442
PceI AGGCCT 1 cut(s) 419
PctI GAATGC 1 cut(s) 391
PfeI GAWTC 2 cut(s) 167, 265
Psp6I CCWGG 2 cut(s) 136, 170
PspGI CCWGG 2 cut(s) 136, 170
PspPI GGNCC 2 cut(s) 184, 328
PstI CTGCAG 1 cut(s) 147
PstNI CAGNNNCTG 1 cut(s) 241
RsaI GTAC 1 cut(s) 212
RsaNI GTAC 1 cut(s) 211
RseI CAYNNNNRTG 1 cut(s) 58
SaqAI TTAA 4 cut(s) 12, 35, 101, 410
Sau96I GGNCC 2 cut(s) 184, 328
ScrFI CCNGG 2 cut(s) 138, 172
SetI ASST 4 cut(s) 107, 132, 139, 156
SfaNI GCATC 2 cut(s) 37, 202
SfcI CTRYAG 1 cut(s) 143
SinI GGWCC 2 cut(s) 184, 328
SmiMI CAYNNNNRTG 1 cut(s) 58
Sse9I AATT 3 cut(s) 406, 451, 466
SseBI AGGCCT 1 cut(s) 419
SsiI CCGC 1 cut(s) 336
SspMI CTAG 1 cut(s) 197
StuI AGGCCT 1 cut(s) 419
StyD4I CCNGG 2 cut(s) 136, 170
TaiI ACGT 1 cut(s) 107
TaqI TCGA 2 cut(s) 268, 308
TasI AATT 3 cut(s) 406, 451, 466
TfiI GAWTC 2 cut(s) 167, 265
Tru1I TTAA 4 cut(s) 12, 35, 101, 410
Tru9I TTAA 4 cut(s) 12, 35, 101, 410
TscAI CASTG 1 cut(s) 126
TseFI GTSAC 1 cut(s) 85
Tsp45I GTSAC 1 cut(s) 85
TspDTI ATGAA 4 cut(s) 42, 240, 398, 459
TspRI CASTG 1 cut(s) 126
VpaK11BI GGWCC 2 cut(s) 184, 328
XapI RAATTY 1 cut(s) 406
XbaI TCTAGA 1 cut(s) 196
XspI CTAG 1 cut(s) 197
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.