Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr6

Orthogroup ID

N/A

Physical Location & Seq

Genomic Coordinates Forward (+)

21340220 .. 21340522

Gene Structure 303 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

N/A

Sequence Viewer

CDS Protein Promoter (2k)

Length: 303 bp

ATGAACGGCCAGGGTAATGTCTCATTTGGTGATCATCACCATGTTCATGATCATGGTATTAATATGAACGCCCAAGATTATGGCTCTAATTTTGAGGCTCCAACATCTGATCAACAATTATCAAGCCTGATGGGATATGATGATGCAACGCTCATGTCATCAGTAGCCACTGGATCGATGGATATTAATGAACTTTTCGGTGAATACTGTGGTGATGAATGCAGTGAATTATTGGCGGCACTCCCCCACGATACTGGGTTTGAATTCGGGGATGCTTGGACTAGTTTGGAACAATTAATGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000981 GO:0000988 GO:0000989 GO:0001067 GO:0001076 GO:0001134 GO:0001135 GO:0003674 GO:0003676 GO:0003677 GO:0003700 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0006355 GO:0006357 GO:0008150 GO:0009889 GO:0009987 GO:0010468 GO:0010556 GO:0019219 GO:0019222 GO:0030154 GO:0031323 GO:0031326 GO:0032502 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043565 GO:0044212 GO:0044424 GO:0044464 GO:0048869 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090 GO:0097159 GO:0140110 GO:1901363 GO:1903506 GO:2000112 GO:2001141

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-binding

Protein Analysis

101

Amino Acids

10.86

Weight (kDa)

4.05

Isoelectric Point (pI)

23.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	236
AclWI	GGATC	1 cut(s)	181
AcoI	YGGCCR	1 cut(s)	7
AcsI	RAATTY	1 cut(s)	263
AgsI	TTSAA	1 cut(s)	263
AhlI	ACTAGT	1 cut(s)	281
AjnI	CCWGG	1 cut(s)	9
Alw26I	GTCTC	1 cut(s)	25
AlwI	GGATC	1 cut(s)	181
AoxI	GGCC	1 cut(s)	7
ApoI	RAATTY	1 cut(s)	263
AseI	ATTAAT	3 cut(s)	60, 186, 296
AsuHPI	GGTGA	4 cut(s)	29, 41, 212, 224
BccI	CCATC	2 cut(s)	124, 172
BceAI	ACGGC	1 cut(s)	22
BciT130I	CCWGG	1 cut(s)	11
BclI	TGATCA	3 cut(s)	31, 49, 109
BcoDI	GTCTC	1 cut(s)	25
BcuI	ACTAGT	1 cut(s)	281
BfaI	CTAG	1 cut(s)	282
BisI	GCNGC	1 cut(s)	237
BlsI	GCNGC	1 cut(s)	238
Bme1390I	CCNGG	1 cut(s)	11
BmiI	GGNNCC	1 cut(s)	99
BmrFI	CCNGG	1 cut(s)	11
BmrI	ACTGGG	1 cut(s)	264
BmsI	GCATC	2 cut(s)	133, 262
BmuI	ACTGGG	1 cut(s)	264
Bsa29I	ATCGAT	1 cut(s)	176
BsaJI	CCNNGG	1 cut(s)	10
Bse1I	ACTGG	2 cut(s)	175, 259
BseBI	CCWGG	1 cut(s)	11
BseCI	ATCGAT	1 cut(s)	176
BseDI	CCNNGG	1 cut(s)	10
BseGI	GGATG	1 cut(s)	277
BseNI	ACTGG	2 cut(s)	175, 259
BshFI	GGCC	1 cut(s)	9
BshVI	ATCGAT	1 cut(s)	176
BsmAI	GTCTC	1 cut(s)	25
BsmI	GAATGC	1 cut(s)	224
BsnI	GGCC	1 cut(s)	9
Bsp143I	GATC	4 cut(s)	31, 49, 109, 173
BspACI	CCGC	1 cut(s)	236
BspANI	GGCC	1 cut(s)	9
BspDI	ATCGAT	1 cut(s)	176
BspHI	TCATGA	1 cut(s)	46
BspLI	GGNNCC	1 cut(s)	99
BspPI	GGATC	1 cut(s)	181
BsrI	ACTGG	2 cut(s)	175, 259
BssECI	CCNNGG	1 cut(s)	10
BssMI	GATC	4 cut(s)	31, 49, 109, 173
Bst2UI	CCWGG	1 cut(s)	11
Bst4CI	ACNGT	1 cut(s)	209
BstF5I	GGATG	1 cut(s)	277
BstKTI	GATC	4 cut(s)	34, 52, 112, 176
BstMAI	GTCTC	1 cut(s)	25
BstMBI	GATC	4 cut(s)	31, 49, 109, 173
BstNI	CCWGG	1 cut(s)	11
BstSCI	CCNGG	1 cut(s)	9
BstXI	CCANNNNNNTGG	2 cut(s)	80, 254
Bsu15I	ATCGAT	1 cut(s)	176
BsuRI	GGCC	1 cut(s)	9
BsuTUI	ATCGAT	1 cut(s)	176
BtsCI	GGATG	1 cut(s)	277
BtsI	GCAGTG	1 cut(s)	229
BtsIMutI	CAGTG	2 cut(s)	168, 229
CciI	TCATGA	1 cut(s)	46
ClaI	ATCGAT	1 cut(s)	176
CviAII	CATG	4 cut(s)	41, 47, 53, 154
CviJI	RGCY	5 cut(s)	9, 84, 98, 126, 167
CviKI_1	RGCY	5 cut(s)	9, 84, 98, 126, 167
DpnI	GATC	4 cut(s)	33, 51, 111, 175
DpnII	GATC	4 cut(s)	31, 49, 109, 173
EaeI	YGGCCR	1 cut(s)	7
EcoRI	GAATTC	1 cut(s)	263
EcoRII	CCWGG	1 cut(s)	9
FaeI	CATG	4 cut(s)	44, 50, 56, 157
FaiI	YATR	7 cut(s)	42, 48, 54, 65, 81, 138, 155
FatI	CATG	4 cut(s)	40, 46, 52, 153
FbaI	TGATCA	3 cut(s)	31, 49, 109
Fnu4HI	GCNGC	1 cut(s)	237
FokI	GGATG	1 cut(s)	284
Fsp4HI	GCNGC	1 cut(s)	237
FspBI	CTAG	1 cut(s)	282
GluI	GCNGC	1 cut(s)	237
HaeIII	GGCC	1 cut(s)	9
Hin1II	CATG	4 cut(s)	44, 50, 56, 157
HphI	GGTGA	4 cut(s)	29, 41, 212, 224
Hpy188I	TCNGA	1 cut(s)	109
Hpy188III	TCNNGA	1 cut(s)	47
HpyCH4III	ACNGT	1 cut(s)	209
HpyCH4V	TGCA	2 cut(s)	146, 222
Hsp92II	CATG	4 cut(s)	44, 50, 56, 157
Ksp22I	TGATCA	3 cut(s)	31, 49, 109
Kzo9I	GATC	4 cut(s)	31, 49, 109, 173
LmnI	GCTCC	1 cut(s)	103
LpnPI	CCDG	4 cut(s)	23, 140, 156, 240
LweI	GCATC	2 cut(s)	133, 262
MaeI	CTAG	1 cut(s)	282
MalI	GATC	4 cut(s)	33, 51, 111, 175
MboI	GATC	4 cut(s)	31, 49, 109, 173
MluCI	AATT	5 cut(s)	88, 116, 227, 263, 293
MmeI	TCCRAC	1 cut(s)	125
MnlI	CCTC	1 cut(s)	88
MseI	TTAA	3 cut(s)	60, 186, 296
MslI	CAYNNNNRTG	3 cut(s)	39, 45, 51
MspR9I	CCNGG	1 cut(s)	11
Mva1269I	GAATGC	1 cut(s)	224
MvaI	CCWGG	1 cut(s)	11
NdeII	GATC	4 cut(s)	31, 49, 109, 173
NlaIII	CATG	4 cut(s)	44, 50, 56, 157
NlaIV	GGNNCC	1 cut(s)	99
PagI	TCATGA	1 cut(s)	46
PctI	GAATGC	1 cut(s)	224
PkrI	GCNGC	1 cut(s)	238
PshBI	ATTAAT	3 cut(s)	60, 186, 296
Psp6I	CCWGG	1 cut(s)	9
PspGI	CCWGG	1 cut(s)	9
PspN4I	GGNNCC	1 cut(s)	99
RseI	CAYNNNNRTG	3 cut(s)	39, 45, 51
SaqAI	TTAA	3 cut(s)	60, 186, 296
SatI	GCNGC	1 cut(s)	237
Sau3AI	GATC	4 cut(s)	31, 49, 109, 173
ScrFI	CCNGG	1 cut(s)	11
SfaNI	GCATC	2 cut(s)	133, 262
SmiMI	CAYNNNNRTG	3 cut(s)	39, 45, 51
SpeI	ACTAGT	1 cut(s)	281
Sse9I	AATT	5 cut(s)	88, 116, 227, 263, 293
SsiI	CCGC	1 cut(s)	236
SspMI	CTAG	1 cut(s)	282
StyD4I	CCNGG	1 cut(s)	9
TaaI	ACNGT	1 cut(s)	209
TaqI	TCGA	1 cut(s)	176
TasI	AATT	5 cut(s)	88, 116, 227, 263, 293
TauI	GCSGC	1 cut(s)	239
Tru1I	TTAA	3 cut(s)	60, 186, 296
Tru9I	TTAA	3 cut(s)	60, 186, 296
TscAI	CASTG	2 cut(s)	175, 229
TspDTI	ATGAA	5 cut(s)	17, 35, 80, 204, 231
TspRI	CASTG	2 cut(s)	175, 229
VspI	ATTAAT	3 cut(s)	60, 186, 296
XapI	RAATTY	1 cut(s)	263
XcmI	CCANNNNNNNNNTGG	1 cut(s)	175
XspI	CTAG	1 cut(s)	282

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.