pycom07g11100

AT-hook motif nuclear-localized protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
N/A
Physical Location & Seq
Reverse (-)
11501327 .. 11501743
417 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 417 bp
ATGGCAGCTCAAAGGCCAGGAACGAGTGAAATTCCATCAGGTTCGCACGCATTTCCCATGACCGAGATACCTAATAACCAGGCAGCAGGGTTACCTGCAGCAGCAACGGCAAGAAAGTCGACTGAAGTTGCATCGGGGTATCAGGTCCCGAATAAACAGGCTGCATCGCTTGGAATGGCCCCACCGCCGCCCAGGGGTGGATCGAATGTTGCTAGCACTTCAGGCACAAAAAAGAGGGGAAGGCCAAGGAAGTATGGCTCCGACGGGACAGTGCCAGCGGCAAAGAGATCATACTCGCCAAGAGTGCCGACTTCATCACTTGCCCCATCAGAGCACAATCAGGATAAGACACCAACATCCGAACCAATTGGTGGGTATCTTCTAACCATTTTAGTATTCACTCATTTGCATTTATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF296

Protein Analysis

139

Amino Acids

14.3

Weight (kDa)

10.22

Isoelectric Point (pI)

56.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 103
AccB7I CCANNNNNTGG 1 cut(s) 371
AccI GTMKAC 1 cut(s) 119
AciI CCGC 3 cut(s) 185, 188, 278
AclWI GGATC 1 cut(s) 208
AcsI RAATTY 1 cut(s) 30
AcuI CTGAAG 2 cut(s) 144, 204
AfiI CCNNNNNNNGG 3 cut(s) 194, 197, 371
AjnI CCWGG 3 cut(s) 16, 78, 191
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
Alw21I GWGCWC 1 cut(s) 336
AlwI GGATC 1 cut(s) 208
AoxI GGCC 3 cut(s) 14, 177, 242
ApeKI GCWGC 5 cut(s) 5, 83, 98, 101, 161
ApoI RAATTY 1 cut(s) 30
AspS9I GGNCC 2 cut(s) 145, 178
AsuNHI GCTAGC 1 cut(s) 212
AvaII GGWCC 1 cut(s) 145
Bbv12I GWGCWC 1 cut(s) 336
BbvI GCAGC 5 cut(s) 17, 95, 110, 113, 148
BccI CCATC 2 cut(s) 43, 334
BceAI ACGGC 1 cut(s) 123
BcgI CGANNNNNNTGC 2 cut(s) 99, 133
BciT130I CCWGG 3 cut(s) 18, 80, 193
BfaI CTAG 1 cut(s) 213
BfmI CTRYAG 1 cut(s) 96
BfuAI ACCTGC 1 cut(s) 103
BisI GCNGC 7 cut(s) 6, 84, 99, 102, 162, 188, 279
BlsI GCNGC 7 cut(s) 7, 85, 100, 103, 163, 189, 280
Bme1390I CCNGG 3 cut(s) 18, 80, 193
Bme18I GGWCC 1 cut(s) 145
BmgT120I GGNCC 2 cut(s) 145, 178
BmiI GGNNCC 3 cut(s) 147, 180, 259
BmrFI CCNGG 3 cut(s) 18, 80, 193
BmsI GCATC 2 cut(s) 140, 173
BmtI GCTAGC 1 cut(s) 216
BsaJI CCNNGG 3 cut(s) 191, 192, 245
Bsc4I CCNNNNNNNGG 3 cut(s) 194, 197, 371
BseBI CCWGG 3 cut(s) 18, 80, 193
BseDI CCNNGG 3 cut(s) 191, 192, 245
BseGI GGATG 1 cut(s) 356
BseLI CCNNNNNNNGG 3 cut(s) 194, 197, 371
BseXI GCAGC 5 cut(s) 17, 95, 110, 113, 148
BshFI GGCC 3 cut(s) 16, 179, 244
BsiHKAI GWGCWC 1 cut(s) 336
BslFI GGGAC 2 cut(s) 131, 280
BslI CCNNNNNNNGG 3 cut(s) 194, 197, 371
BsmFI GGGAC 2 cut(s) 131, 280
BsnI GGCC 3 cut(s) 16, 179, 244
Bsp1286I GDGCHC 1 cut(s) 336
Bsp143I GATC 2 cut(s) 200, 287
BspACI CCGC 3 cut(s) 185, 188, 278
BspANI GGCC 3 cut(s) 16, 179, 244
BspLI GGNNCC 3 cut(s) 147, 180, 259
BspMAI CTGCAG 1 cut(s) 100
BspMI ACCTGC 1 cut(s) 103
BspOI GCTAGC 1 cut(s) 216
BspPI GGATC 1 cut(s) 208
BssECI CCNNGG 3 cut(s) 191, 192, 245
BssMI GATC 2 cut(s) 200, 287
BssT1I CCWWGG 1 cut(s) 245
Bst2UI CCWGG 3 cut(s) 18, 80, 193
Bst4CI ACNGT 1 cut(s) 271
BstC8I GCNNGC 3 cut(s) 48, 214, 276
BstEII GGTNACC 1 cut(s) 90
BstF5I GGATG 1 cut(s) 356
BstKTI GATC 2 cut(s) 203, 290
BstMBI GATC 2 cut(s) 200, 287
BstMWI GCNNNNNNNGC 3 cut(s) 107, 222, 304
BstNI CCWGG 3 cut(s) 18, 80, 193
BstPI GGTNACC 1 cut(s) 90
BstSCI CCNGG 3 cut(s) 16, 78, 191
BstSFI CTRYAG 1 cut(s) 96
BstV1I GCAGC 5 cut(s) 17, 95, 110, 113, 148
BsuRI GGCC 3 cut(s) 16, 179, 244
BtgZI GCGATG 1 cut(s) 150
BtsCI GGATG 1 cut(s) 356
BtsIMutI CAGTG 1 cut(s) 276
BveI ACCTGC 1 cut(s) 103
Cac8I GCNNGC 3 cut(s) 48, 214, 276
Cfr13I GGNCC 2 cut(s) 145, 178
CviAII CATG 1 cut(s) 58
CviJI RGCY 6 cut(s) 8, 16, 161, 179, 244, 258
CviKI_1 RGCY 6 cut(s) 8, 16, 161, 179, 244, 258
DpnI GATC 2 cut(s) 202, 289
DpnII GATC 2 cut(s) 200, 287
Eco130I CCWWGG 1 cut(s) 245
Eco47I GGWCC 1 cut(s) 145
Eco57I CTGAAG 2 cut(s) 144, 204
Eco91I GGTNACC 1 cut(s) 90
EcoO109I RGGNCCY 1 cut(s) 145
EcoO65I GGTNACC 1 cut(s) 90
EcoRII CCWGG 3 cut(s) 16, 78, 191
EcoT14I CCWWGG 1 cut(s) 245
ErhI CCWWGG 1 cut(s) 245
FaeI CATG 1 cut(s) 61
FaiI YATR 4 cut(s) 59, 255, 292, 415
FaqI GGGAC 2 cut(s) 131, 280
FatI CATG 1 cut(s) 57
FblI GTMKAC 1 cut(s) 119
Fnu4HI GCNGC 7 cut(s) 6, 84, 99, 102, 162, 188, 279
FokI GGATG 1 cut(s) 343
Fsp4HI GCNGC 7 cut(s) 6, 84, 99, 102, 162, 188, 279
FspBI CTAG 1 cut(s) 213
GluI GCNGC 7 cut(s) 6, 84, 99, 102, 162, 188, 279
HaeIII GGCC 3 cut(s) 16, 179, 244
Hin1II CATG 1 cut(s) 61
HincII GTYRAC 1 cut(s) 120
HindII GTYRAC 1 cut(s) 120
Hpy166II GTNNAC 1 cut(s) 120
Hpy188I TCNGA 3 cut(s) 262, 331, 361
Hpy188III TCNNGA 2 cut(s) 148, 341
Hpy8I GTNNAC 1 cut(s) 120
Hpy99I CGWCG 1 cut(s) 266
HpyAV CCTTC 1 cut(s) 234
HpyCH4III ACNGT 1 cut(s) 271
HpyCH4V TGCA 4 cut(s) 98, 131, 164, 409
HpyF10VI GCNNNNNNNGC 3 cut(s) 107, 222, 304
Hsp92II CATG 1 cut(s) 61
Kzo9I GATC 2 cut(s) 200, 287
LmnI GCTCC 1 cut(s) 263
Lsp1109I GCAGC 5 cut(s) 17, 95, 110, 113, 148
LweI GCATC 2 cut(s) 140, 173
MaeI CTAG 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 90
MalI GATC 2 cut(s) 202, 289
MboI GATC 2 cut(s) 200, 287
MboII GAAGA 1 cut(s) 371
MfeI CAATTG 1 cut(s) 366
MhlI GDGCHC 1 cut(s) 336
MluCI AATT 2 cut(s) 30, 366
MmeI TCCRAC 1 cut(s) 285
MnlI CCTC 1 cut(s) 228
MspA1I CMGCKG 1 cut(s) 278
MspR9I CCNGG 3 cut(s) 18, 80, 193
MunI CAATTG 1 cut(s) 366
MvaI CCWGG 3 cut(s) 18, 80, 193
MwoI GCNNNNNNNGC 3 cut(s) 107, 222, 304
NdeII GATC 2 cut(s) 200, 287
NheI GCTAGC 1 cut(s) 212
NlaIII CATG 1 cut(s) 61
NlaIV GGNNCC 3 cut(s) 147, 180, 259
PasI CCCWGGG 1 cut(s) 192
PflMI CCANNNNNTGG 1 cut(s) 371
PkrI GCNGC 7 cut(s) 7, 85, 100, 103, 163, 189, 280
PpuMI RGGWCCY 1 cut(s) 145
Psp5II RGGWCCY 1 cut(s) 145
Psp6I CCWGG 3 cut(s) 16, 78, 191
PspEI GGTNACC 1 cut(s) 90
PspGI CCWGG 3 cut(s) 16, 78, 191
PspN4I GGNNCC 3 cut(s) 147, 180, 259
PspPI GGNCC 2 cut(s) 145, 178
PspPPI RGGWCCY 1 cut(s) 145
PstI CTGCAG 1 cut(s) 100
SalI GTCGAC 1 cut(s) 118
SatI GCNGC 7 cut(s) 6, 84, 99, 102, 162, 188, 279
Sau3AI GATC 2 cut(s) 200, 287
Sau96I GGNCC 2 cut(s) 145, 178
ScrFI CCNGG 3 cut(s) 18, 80, 193
SduI GDGCHC 1 cut(s) 336
SetI ASST 5 cut(s) 10, 43, 73, 97, 147
SfaNI GCATC 2 cut(s) 140, 173
SfcI CTRYAG 1 cut(s) 96
SinI GGWCC 1 cut(s) 145
Sse9I AATT 2 cut(s) 30, 366
SsiI CCGC 3 cut(s) 185, 188, 278
SspMI CTAG 1 cut(s) 213
StyD4I CCNGG 3 cut(s) 16, 78, 191
StyI CCWWGG 1 cut(s) 245
TaaI ACNGT 1 cut(s) 271
TaqI TCGA 2 cut(s) 119, 203
TaqII GACCGA 1 cut(s) 77
TasI AATT 2 cut(s) 30, 366
TauI GCSGC 2 cut(s) 190, 281
TscAI CASTG 1 cut(s) 276
TseI GCWGC 5 cut(s) 5, 83, 98, 101, 161
TspDTI ATGAA 1 cut(s) 303
TspRI CASTG 1 cut(s) 276
Van91I CCANNNNNTGG 1 cut(s) 371
VpaK11BI GGWCC 1 cut(s) 145
XapI RAATTY 1 cut(s) 30
XmiI GTMKAC 1 cut(s) 119
XspI CTAG 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.