pycom08g02060

Belongs to the AAA ATPase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0029337
Physical Location & Seq
Reverse (-)
1521851 .. 1522287
437 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 303 bp
ATGACAAGCCTCTTTGCTGTATTGAGCTTTATTGACGGACTGTGGTCGACCTGTGGAGAGGAAAGAATTGTCGTGTTTACGACGAACCACAAGGACCGGCTTAATCCAGCTGGTTTCAAGAAATTGGCATATAATTACCTGCTGATTCACGAGCACACACTTTTCGGAGAAATTGAAATGTTGCTCGACAGGGCACAAGCAACGCCTGCCGAAGTTGCCGGAGAGCTGATGAGGAGCGATGATGCTCATGTTTCCCTTCAAGGTCCTATCGAATTCCTCCGAGGAAAGACTGATAGAACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA AAA_assoc

Protein Analysis

101

Amino Acids

11.27

Weight (kDa)

5.46

Isoelectric Point (pI)

28.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AAA_lid_At3g28540 PF25568 35 - 95 1.4e-18 At3g28540-like, AAA+ ATPase lid domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029337)

Species Orthologous Gene IDs
pyrus_communis pycom08g02060 pycom08g02080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 147
AccI GTMKAC 1 cut(s) 47
AcsI RAATTY 1 cut(s) 272
AgsI TTSAA 3 cut(s) 118, 176, 260
AluBI AGCT 3 cut(s) 27, 110, 226
AluI AGCT 3 cut(s) 27, 110, 226
Alw21I GWGCWC 1 cut(s) 156
ApoI RAATTY 1 cut(s) 272
AspS9I GGNCC 2 cut(s) 94, 263
AvaII GGWCC 2 cut(s) 94, 263
BaeGI GKGCMC 1 cut(s) 196
BauI CACGAG 1 cut(s) 149
Bbv12I GWGCWC 1 cut(s) 156
BfuAI ACCTGC 1 cut(s) 147
Bme18I GGWCC 2 cut(s) 94, 263
BmgT120I GGNCC 2 cut(s) 94, 263
BmsI GCATC 1 cut(s) 232
BoxI GACNNNNGTC 1 cut(s) 43
BsaJI CCNNGG 1 cut(s) 280
Bse118I RCCGGY 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 280
BseRI GAGGAG 1 cut(s) 247
BseSI GKGCMC 1 cut(s) 196
BsiHKAI GWGCWC 1 cut(s) 156
BsiSI CCGG 2 cut(s) 97, 219
Bsp1286I GDGCHC 2 cut(s) 156, 196
BspMI ACCTGC 1 cut(s) 147
BsrFI RCCGGY 1 cut(s) 96
BssAI RCCGGY 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 280
BssSI CACGAG 1 cut(s) 149
Bst2BI CACGAG 1 cut(s) 149
Bst4CI ACNGT 1 cut(s) 42
BstAPI GCANNNNNTGC 1 cut(s) 206
BstC8I GCNNGC 1 cut(s) 207
BstMWI GCNNNNNNNGC 2 cut(s) 206, 215
BstPAI GACNNNNGTC 1 cut(s) 43
BstSLI GKGCMC 1 cut(s) 196
BtgZI GCGATG 1 cut(s) 252
BveI ACCTGC 1 cut(s) 147
Cac8I GCNNGC 1 cut(s) 207
Cfr10I RCCGGY 1 cut(s) 96
Cfr13I GGNCC 2 cut(s) 94, 263
CviAII CATG 1 cut(s) 248
CviJI RGCY 5 cut(s) 9, 27, 100, 110, 226
CviKI_1 RGCY 5 cut(s) 9, 27, 100, 110, 226
Eco47I GGWCC 2 cut(s) 94, 263
EcoO109I RGGNCCY 1 cut(s) 263
EcoRI GAATTC 1 cut(s) 272
FaeI CATG 1 cut(s) 251
FaiI YATR 3 cut(s) 130, 132, 249
FatI CATG 1 cut(s) 247
FblI GTMKAC 1 cut(s) 47
HapII CCGG 2 cut(s) 97, 219
Hin1II CATG 1 cut(s) 251
HincII GTYRAC 1 cut(s) 48
HindII GTYRAC 1 cut(s) 48
HinfI GANTC 1 cut(s) 145
HpaII CCGG 2 cut(s) 97, 219
Hpy166II GTNNAC 2 cut(s) 48, 78
Hpy188I TCNGA 2 cut(s) 167, 281
Hpy188III TCNNGA 2 cut(s) 118, 149
Hpy8I GTNNAC 2 cut(s) 48, 78
Hpy99I CGWCG 1 cut(s) 85
HpyAV CCTTC 1 cut(s) 266
HpyCH4III ACNGT 1 cut(s) 42
HpyF10VI GCNNNNNNNGC 2 cut(s) 206, 215
Hsp92II CATG 1 cut(s) 251
LmnI GCTCC 1 cut(s) 234
LpnPI CCDG 8 cut(s) 64, 96, 110, 120, 152, 175, 219, 232
LweI GCATC 1 cut(s) 232
MhlI GDGCHC 2 cut(s) 156, 196
MluCI AATT 5 cut(s) 66, 122, 133, 171, 272
MnlI CCTC 5 cut(s) 20, 52, 225, 275, 287
MseI TTAA 1 cut(s) 102
MspA1I CMGCKG 1 cut(s) 110
MspI CCGG 2 cut(s) 97, 219
MwoI GCNNNNNNNGC 2 cut(s) 206, 215
NlaIII CATG 1 cut(s) 251
PfeI GAWTC 1 cut(s) 145
PpuMI RGGWCCY 1 cut(s) 263
PshAI GACNNNNGTC 1 cut(s) 43
Psp5II RGGWCCY 1 cut(s) 263
PspPI GGNCC 2 cut(s) 94, 263
PspPPI RGGWCCY 1 cut(s) 263
PvuII CAGCTG 1 cut(s) 110
SalI GTCGAC 1 cut(s) 46
SaqAI TTAA 1 cut(s) 102
Sau96I GGNCC 2 cut(s) 94, 263
SduI GDGCHC 2 cut(s) 156, 196
SetI ASST 7 cut(s) 29, 53, 112, 141, 228, 265, 302
SfaNI GCATC 1 cut(s) 232
SinI GGWCC 2 cut(s) 94, 263
Sse9I AATT 5 cut(s) 66, 122, 133, 171, 272
TaaI ACNGT 1 cut(s) 42
TaqI TCGA 3 cut(s) 47, 186, 270
TasI AATT 5 cut(s) 66, 122, 133, 171, 272
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TspGWI ACGGA 1 cut(s) 51
VpaK11BI GGWCC 2 cut(s) 94, 263
XapI RAATTY 1 cut(s) 272
XmiI GTMKAC 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.