pycom08g02080

Belongs to the AAA ATPase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr8
OG0029337
Physical Location & Seq
Reverse (-)
1550886 .. 1551322
437 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 303 bp
ATGACAAGCCTCTCTGCTGTATTGAGCTTCATTGACGGACTGTGGTCGACCTGTGGAGAGGAAAGAATTGTAGTGTTTACGACAAACCACAAGGACCGGCTTGATCCAGCTGGTTTCAAGACATTGGCATATAATTACCTGCTGATTCACGAGCACACACTTTTCGGAGAAATTGAAATGTTGCTCAACAGGGCACAAGCAACGCCTGCAGAAGTTGCCGGAGAGCTAATGAGGAGCGATGATGCTCATGTTACCCTTCAAGGTCTTATCGAATTCCTCCGAGGAAAGACTGATAGAACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA AAA_assoc

Protein Analysis

101

Amino Acids

11.21

Weight (kDa)

5.21

Isoelectric Point (pI)

29.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AAA_lid_At3g28540 PF25568 36 - 96 7.2e-20 At3g28540-like, AAA+ ATPase lid domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029337)

Species Orthologous Gene IDs
pyrus_communis pycom08g02060 pycom08g02080

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 147
AccI GTMKAC 1 cut(s) 47
AclWI GGATC 1 cut(s) 98
AcsI RAATTY 1 cut(s) 272
AgsI TTSAA 3 cut(s) 118, 176, 260
AluBI AGCT 3 cut(s) 27, 110, 226
AluI AGCT 3 cut(s) 27, 110, 226
Alw21I GWGCWC 1 cut(s) 156
AlwI GGATC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 272
AspS9I GGNCC 1 cut(s) 94
AvaII GGWCC 1 cut(s) 94
BaeGI GKGCMC 1 cut(s) 196
BauI CACGAG 1 cut(s) 149
Bbv12I GWGCWC 1 cut(s) 156
BfmI CTRYAG 1 cut(s) 207
BfuAI ACCTGC 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 94
BmsI GCATC 1 cut(s) 232
BoxI GACNNNNGTC 1 cut(s) 43
BsaJI CCNNGG 1 cut(s) 280
Bse118I RCCGGY 1 cut(s) 96
BseDI CCNNGG 1 cut(s) 280
BseRI GAGGAG 1 cut(s) 247
BseSI GKGCMC 1 cut(s) 196
BsiHKAI GWGCWC 1 cut(s) 156
BsiSI CCGG 2 cut(s) 97, 219
Bsp1286I GDGCHC 2 cut(s) 156, 196
Bsp143I GATC 1 cut(s) 103
BspMAI CTGCAG 1 cut(s) 211
BspMI ACCTGC 1 cut(s) 147
BspPI GGATC 1 cut(s) 98
BsrFI RCCGGY 1 cut(s) 96
BssAI RCCGGY 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 280
BssMI GATC 1 cut(s) 103
BssSI CACGAG 1 cut(s) 149
Bst2BI CACGAG 1 cut(s) 149
Bst4CI ACNGT 1 cut(s) 42
BstAPI GCANNNNNTGC 2 cut(s) 206, 215
BstC8I GCNNGC 1 cut(s) 207
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstMWI GCNNNNNNNGC 2 cut(s) 206, 215
BstPAI GACNNNNGTC 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 207
BstSLI GKGCMC 1 cut(s) 196
BtgZI GCGATG 1 cut(s) 252
BveI ACCTGC 1 cut(s) 147
Cac8I GCNNGC 1 cut(s) 207
Cfr10I RCCGGY 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 94
CviAII CATG 1 cut(s) 248
CviJI RGCY 5 cut(s) 9, 27, 100, 110, 226
CviKI_1 RGCY 5 cut(s) 9, 27, 100, 110, 226
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
Eco47I GGWCC 1 cut(s) 94
EcoRI GAATTC 1 cut(s) 272
FaeI CATG 1 cut(s) 251
FaiI YATR 3 cut(s) 130, 132, 249
FatI CATG 1 cut(s) 247
FblI GTMKAC 1 cut(s) 47
HapII CCGG 2 cut(s) 97, 219
Hin1II CATG 1 cut(s) 251
HincII GTYRAC 1 cut(s) 48
HindII GTYRAC 1 cut(s) 48
HinfI GANTC 1 cut(s) 145
HpaII CCGG 2 cut(s) 97, 219
Hpy166II GTNNAC 2 cut(s) 48, 78
Hpy188I TCNGA 2 cut(s) 167, 281
Hpy188III TCNNGA 2 cut(s) 118, 149
Hpy8I GTNNAC 2 cut(s) 48, 78
HpyAV CCTTC 1 cut(s) 266
HpyCH4III ACNGT 1 cut(s) 42
HpyCH4V TGCA 1 cut(s) 209
HpyF10VI GCNNNNNNNGC 2 cut(s) 206, 215
Hsp92II CATG 1 cut(s) 251
Kzo9I GATC 1 cut(s) 103
LmnI GCTCC 1 cut(s) 234
LpnPI CCDG 8 cut(s) 64, 96, 110, 120, 152, 175, 219, 232
LweI GCATC 1 cut(s) 232
MaeIII GTNAC 1 cut(s) 250
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MhlI GDGCHC 2 cut(s) 156, 196
MluCI AATT 4 cut(s) 66, 133, 171, 272
MnlI CCTC 5 cut(s) 20, 52, 225, 275, 287
MspA1I CMGCKG 1 cut(s) 110
MspI CCGG 2 cut(s) 97, 219
MwoI GCNNNNNNNGC 2 cut(s) 206, 215
NdeII GATC 1 cut(s) 103
NlaIII CATG 1 cut(s) 251
PfeI GAWTC 1 cut(s) 145
PshAI GACNNNNGTC 1 cut(s) 43
PspPI GGNCC 1 cut(s) 94
PstI CTGCAG 1 cut(s) 211
PvuII CAGCTG 1 cut(s) 110
SalI GTCGAC 1 cut(s) 46
Sau3AI GATC 1 cut(s) 103
Sau96I GGNCC 1 cut(s) 94
SduI GDGCHC 2 cut(s) 156, 196
SetI ASST 7 cut(s) 29, 53, 112, 141, 228, 265, 302
SfaNI GCATC 1 cut(s) 232
SfcI CTRYAG 1 cut(s) 207
SinI GGWCC 1 cut(s) 94
Sse9I AATT 4 cut(s) 66, 133, 171, 272
TaaI ACNGT 1 cut(s) 42
TaqI TCGA 2 cut(s) 47, 270
TasI AATT 4 cut(s) 66, 133, 171, 272
TfiI GAWTC 1 cut(s) 145
TspDTI ATGAA 1 cut(s) 19
TspGWI ACGGA 1 cut(s) 51
VpaK11BI GGWCC 1 cut(s) 94
XapI RAATTY 1 cut(s) 272
XmiI GTMKAC 1 cut(s) 47
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.