pycom09g00580

Protein GLUTAMINE DUMPER

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
N/A
Physical Location & Seq
Reverse (-)
450773 .. 451300
528 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 486 bp
ATGCCCAATAGTTGTACATTGCAATCATTTTGTGTAAAACTAATCCCATATATCTTTGTAAATGTCCTAAATTTATACATCAATCAAACTTTCCTGTTGTCATCAGATCACTTATACGAGTGTGATAGATTGGAAATTGAACTGGAGAGCAAAGCATCAGATGGCTATCTAGCTAGACAGTGTGATATAGCAATGTGGACTGCAAATTCCACCACCGCGCCTGGCGGTTTCGTTGGGCTCGTACGGAATCCAGCGACATCTGCCACCGCCATAGCCTTCATTCTTGGCTTTCCGACGGCGGTCCTGATTCTAGTTTGCCTCTTACATTATTTTCTTAAAACTTGGCCCAACTCAAGAAGTGATGCAAGAAGTGATGCAGGTGATTCTTGTGAGCCAAGGATTCTAGTGATAATGCCTGGAGAGCAAACACCCACATACTTGGCAAAGCCCCTCCCTAATCCCACTCACCAGACTCAAAATGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

162

Amino Acids

17.76

Weight (kDa)

5.49

Isoelectric Point (pI)

54.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 368
Acc36I ACCTGC 1 cut(s) 368
AccII CGCG 1 cut(s) 218
AciI CCGC 4 cut(s) 216, 225, 267, 299
AcsI RAATTY 2 cut(s) 70, 205
AfaI GTAC 2 cut(s) 16, 243
AgsI TTSAA 1 cut(s) 140
AjnI CCWGG 2 cut(s) 220, 415
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
AoxI GGCC 1 cut(s) 344
ApoI RAATTY 2 cut(s) 70, 205
AspLEI GCGC 1 cut(s) 220
AspS9I GGNCC 2 cut(s) 301, 345
AsuHPI GGTGA 2 cut(s) 392, 458
AvaII GGWCC 1 cut(s) 301
BanII GRGCYC 1 cut(s) 240
BccI CCATC 1 cut(s) 155
BceAI ACGGC 1 cut(s) 312
BciT130I CCWGG 2 cut(s) 222, 417
BfaI CTAG 4 cut(s) 170, 174, 311, 404
BfuAI ACCTGC 1 cut(s) 368
Bme1390I CCNGG 2 cut(s) 222, 417
Bme18I GGWCC 1 cut(s) 301
BmgT120I GGNCC 2 cut(s) 301, 345
BmrFI CCNGG 2 cut(s) 222, 417
BmsI GCATC 3 cut(s) 164, 352, 364
BoxI GACNNNNGTC 1 cut(s) 299
BpmI CTGGAG 2 cut(s) 164, 438
BpuEI CTTGAG 1 cut(s) 337
BsaBI GATNNNNATC 1 cut(s) 165
BsaJI CCNNGG 1 cut(s) 395
Bse1I ACTGG 1 cut(s) 147
Bse3DI GCAATG 2 cut(s) 17, 198
Bse8I GATNNNNATC 1 cut(s) 165
BseBI CCWGG 2 cut(s) 222, 417
BseDI CCNNGG 1 cut(s) 395
BseJI GATNNNNATC 1 cut(s) 165
BseMI GCAATG 2 cut(s) 17, 198
BseNI ACTGG 1 cut(s) 147
Bsh1236I CGCG 1 cut(s) 218
BshFI GGCC 1 cut(s) 346
BsiWI CGTACG 1 cut(s) 241
BsnI GGCC 1 cut(s) 346
Bsp1286I GDGCHC 1 cut(s) 240
Bsp1407I TGTACA 1 cut(s) 14
Bsp143I GATC 1 cut(s) 106
BspACI CCGC 4 cut(s) 216, 225, 267, 299
BspANI GGCC 1 cut(s) 346
BspFNI CGCG 1 cut(s) 218
BspMI ACCTGC 1 cut(s) 368
BsrDI GCAATG 2 cut(s) 17, 198
BsrGI TGTACA 1 cut(s) 14
BsrI ACTGG 1 cut(s) 147
BssECI CCNNGG 1 cut(s) 395
BssMI GATC 1 cut(s) 106
BssT1I CCWWGG 1 cut(s) 395
Bst2UI CCWGG 2 cut(s) 222, 417
Bst4CI ACNGT 1 cut(s) 180
BstAUI TGTACA 1 cut(s) 14
BstFNI CGCG 1 cut(s) 218
BstHHI GCGC 1 cut(s) 220
BstKTI GATC 1 cut(s) 109
BstMBI GATC 1 cut(s) 106
BstMWI GCNNNNNNNGC 2 cut(s) 260, 421
BstNI CCWGG 2 cut(s) 222, 417
BstPAI GACNNNNGTC 1 cut(s) 299
BstSCI CCNGG 2 cut(s) 220, 415
BstUI CGCG 1 cut(s) 218
BstXI CCANNNNNNTGG 1 cut(s) 439
BsuRI GGCC 1 cut(s) 346
BtsIMutI CAGTG 1 cut(s) 185
BveI ACCTGC 1 cut(s) 368
CfoI GCGC 1 cut(s) 220
Cfr13I GGNCC 2 cut(s) 301, 345
Csp6I GTAC 2 cut(s) 15, 242
CviAII CATG 1 cut(s) 483
CviJI RGCY 8 cut(s) 165, 173, 238, 275, 288, 346, 394, 448
CviKI_1 RGCY 8 cut(s) 165, 173, 238, 275, 288, 346, 394, 448
CviQI GTAC 2 cut(s) 15, 242
DpnI GATC 1 cut(s) 108
DpnII GATC 1 cut(s) 106
Eco130I CCWWGG 1 cut(s) 395
Eco24I GRGCYC 1 cut(s) 240
Eco47I GGWCC 1 cut(s) 301
EcoRII CCWGG 2 cut(s) 220, 415
EcoT14I CCWWGG 1 cut(s) 395
EcoT22I ATGCAT 1 cut(s) 484
EcoT38I GRGCYC 1 cut(s) 240
ErhI CCWWGG 1 cut(s) 395
FaeI CATG 1 cut(s) 486
FaiI YATR 8 cut(s) 49, 51, 76, 115, 188, 272, 436, 484
FatI CATG 1 cut(s) 482
FriOI GRGCYC 1 cut(s) 240
FspBI CTAG 4 cut(s) 170, 174, 311, 404
GlaI GCGC 1 cut(s) 219
GsuI CTGGAG 2 cut(s) 164, 438
HaeIII GGCC 1 cut(s) 346
HhaI GCGC 1 cut(s) 220
Hin1II CATG 1 cut(s) 486
Hin6I GCGC 1 cut(s) 218
HinP1I GCGC 1 cut(s) 218
HinfI GANTC 5 cut(s) 247, 307, 383, 400, 472
HphI GGTGA 2 cut(s) 392, 458
Hpy166II GTNNAC 1 cut(s) 198
Hpy188I TCNGA 3 cut(s) 106, 160, 294
Hpy188III TCNNGA 2 cut(s) 304, 354
Hpy8I GTNNAC 1 cut(s) 198
Hpy99I CGWCG 1 cut(s) 298
HpyAV CCTTC 1 cut(s) 286
HpyCH4III ACNGT 1 cut(s) 180
HpyCH4V TGCA 5 cut(s) 22, 203, 365, 377, 482
HpyF10VI GCNNNNNNNGC 2 cut(s) 260, 421
Hsp92II CATG 1 cut(s) 486
HspAI GCGC 1 cut(s) 218
Kzo9I GATC 1 cut(s) 106
LweI GCATC 3 cut(s) 164, 352, 364
MaeI CTAG 4 cut(s) 170, 174, 311, 404
MalI GATC 1 cut(s) 108
MboI GATC 1 cut(s) 106
MhlI GDGCHC 1 cut(s) 240
MluCI AATT 3 cut(s) 70, 135, 205
MlyI GAGTC 1 cut(s) 466
MmeI TCCRAC 1 cut(s) 317
MnlI CCTC 2 cut(s) 329, 461
Mph1103I ATGCAT 1 cut(s) 484
MseI TTAA 1 cut(s) 336
MspR9I CCNGG 2 cut(s) 222, 417
MvaI CCWGG 2 cut(s) 222, 417
MvnI CGCG 1 cut(s) 218
MwoI GCNNNNNNNGC 2 cut(s) 260, 421
NdeII GATC 1 cut(s) 106
NlaIII CATG 1 cut(s) 486
NsiI ATGCAT 1 cut(s) 484
PaqCI CACCTGC 1 cut(s) 368
PcsI WCGNNNNNNNCGW 1 cut(s) 237
PfeI GAWTC 4 cut(s) 247, 307, 383, 400
Pfl23II CGTACG 1 cut(s) 241
PleI GAGTC 1 cut(s) 466
PpsI GAGTC 1 cut(s) 466
PshAI GACNNNNGTC 1 cut(s) 299
Psp6I CCWGG 2 cut(s) 220, 415
PspGI CCWGG 2 cut(s) 220, 415
PspLI CGTACG 1 cut(s) 241
PspPI GGNCC 2 cut(s) 301, 345
RsaI GTAC 2 cut(s) 16, 243
RsaNI GTAC 2 cut(s) 15, 242
SaqAI TTAA 1 cut(s) 336
Sau3AI GATC 1 cut(s) 106
Sau96I GGNCC 2 cut(s) 301, 345
SchI GAGTC 1 cut(s) 466
ScrFI CCNGG 2 cut(s) 222, 417
SduI GDGCHC 1 cut(s) 240
SetI ASST 2 cut(s) 175, 382
SfaNI GCATC 3 cut(s) 164, 352, 364
SinI GGWCC 1 cut(s) 301
SmlI CTYRAG 1 cut(s) 352
SmoI CTYRAG 1 cut(s) 352
Sse9I AATT 3 cut(s) 70, 135, 205
SsiI CCGC 4 cut(s) 216, 225, 267, 299
SspMI CTAG 4 cut(s) 170, 174, 311, 404
StyD4I CCNGG 2 cut(s) 220, 415
StyI CCWWGG 1 cut(s) 395
TaaI ACNGT 1 cut(s) 180
TasI AATT 3 cut(s) 70, 135, 205
TatI WGTACW 1 cut(s) 14
TfiI GAWTC 4 cut(s) 247, 307, 383, 400
Tru1I TTAA 1 cut(s) 336
Tru9I TTAA 1 cut(s) 336
TscAI CASTG 1 cut(s) 185
TspDTI ATGAA 1 cut(s) 268
TspGWI ACGGA 1 cut(s) 259
TspRI CASTG 1 cut(s) 185
VpaK11BI GGWCC 1 cut(s) 301
XapI RAATTY 2 cut(s) 70, 205
XspI CTAG 4 cut(s) 170, 174, 311, 404
Zsp2I ATGCAT 1 cut(s) 484
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.