pycom09g02540

F-box FBD LRR-repeat protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
N/A
Physical Location & Seq
Reverse (-)
1903779 .. 1904006
228 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 228 bp
ATGATTGCATTTGTCGAGTGGTGGAGTATAGAGTTGAAGTGTGACAGGTTTGATTTGCCTAATTGTGTATTTAAGTGTGATTCCTCGAGGACTCTCACATTAAGTAAAGCCAGTTACATTCCAATTTCTCCTCAGCCAGCAGAAGATACAAAATCTAGGTTTTGTTTTTCATCTTCTCTTGTTAAGGCCACTGGTCTTCGTTTGCTTCACACTTTGTCTCTAACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.5

Weight (kDa)

8.45

Isoelectric Point (pI)

46.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 85
AgsI TTSAA 1 cut(s) 37
Alw26I GTCTC 1 cut(s) 222
Ama87I CYCGRG 1 cut(s) 85
AoxI GGCC 1 cut(s) 186
AvaI CYCGRG 1 cut(s) 85
BbsI GAAGAC 1 cut(s) 188
BbvCI CCTCAGC 1 cut(s) 132
BcoDI GTCTC 1 cut(s) 222
BfaI CTAG 1 cut(s) 156
BmeT110I CYCGRG 1 cut(s) 85
BpiI GAAGAC 1 cut(s) 188
Bpu10I CCTNAGC 1 cut(s) 132
Bse1I ACTGG 2 cut(s) 111, 196
BseMII CTCAG 1 cut(s) 146
BseNI ACTGG 2 cut(s) 111, 196
BseRI GAGGAG 1 cut(s) 120
BshFI GGCC 1 cut(s) 188
BsiHKCI CYCGRG 1 cut(s) 85
BsmAI GTCTC 1 cut(s) 222
BsnI GGCC 1 cut(s) 188
BsoBI CYCGRG 1 cut(s) 85
BspANI GGCC 1 cut(s) 188
BspCNI CTCAG 1 cut(s) 145
BsrI ACTGG 2 cut(s) 111, 196
BstC8I GCNNGC 1 cut(s) 138
BstDEI CTNAG 1 cut(s) 132
BstMAI GTCTC 1 cut(s) 222
BstV2I GAAGAC 1 cut(s) 188
BsuRI GGCC 1 cut(s) 188
BtsIMutI CAGTG 1 cut(s) 189
Cac8I GCNNGC 1 cut(s) 138
CviJI RGCY 3 cut(s) 110, 136, 188
CviKI_1 RGCY 3 cut(s) 110, 136, 188
DdeI CTNAG 1 cut(s) 132
Eco88I CYCGRG 1 cut(s) 85
FaiI YATR 1 cut(s) 29
FspBI CTAG 1 cut(s) 156
HaeIII GGCC 1 cut(s) 188
HinfI GANTC 2 cut(s) 80, 91
HpyCH4V TGCA 1 cut(s) 8
HpyF3I CTNAG 1 cut(s) 132
LpnPI CCDG 4 cut(s) 31, 124, 150, 177
MaeI CTAG 1 cut(s) 156
MaeIII GTNAC 2 cut(s) 41, 113
MboII GAAGA 3 cut(s) 155, 165, 188
MluCI AATT 2 cut(s) 61, 123
MlyI GAGTC 1 cut(s) 85
MnlI CCTC 3 cut(s) 81, 94, 141
MseI TTAA 4 cut(s) 72, 101, 183, 226
NmuCI GTSAC 1 cut(s) 41
PaeR7I CTCGAG 1 cut(s) 85
PfeI GAWTC 1 cut(s) 80
PleI GAGTC 1 cut(s) 85
PpsI GAGTC 1 cut(s) 85
PspXI VCTCGAGB 1 cut(s) 85
SaqAI TTAA 4 cut(s) 72, 101, 183, 226
SchI GAGTC 1 cut(s) 85
SetI ASST 2 cut(s) 50, 161
Sfr274I CTCGAG 1 cut(s) 85
SgeI CNNG 9 cut(s) 28, 58, 97, 99, 123, 149, 168, 191, 204
SlaI CTCGAG 1 cut(s) 85
SmlI CTYRAG 1 cut(s) 85
SmoI CTYRAG 1 cut(s) 85
Sse9I AATT 2 cut(s) 61, 123
SspMI CTAG 1 cut(s) 156
TaqI TCGA 2 cut(s) 15, 86
TasI AATT 2 cut(s) 61, 123
TfiI GAWTC 1 cut(s) 80
Tru1I TTAA 4 cut(s) 72, 101, 183, 226
Tru9I TTAA 4 cut(s) 72, 101, 183, 226
TscAI CASTG 1 cut(s) 196
TseFI GTSAC 1 cut(s) 41
Tsp45I GTSAC 1 cut(s) 41
TspDTI ATGAA 1 cut(s) 159
TspRI CASTG 1 cut(s) 196
XhoI CTCGAG 1 cut(s) 85
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.