pycom09g03140

Regulatory subunit of the dimeric E1 enzyme. E1 activates RUB1 NEDD8 by first adenylating its C-terminal glycine residue with ATP, thereafter linking this residue to the side chain of the catalytic cysteine, yielding a RUB1-ECR1 thioester and free AMP. E1 finally transfers RUB1 to the catalytic cysteine of RCE1

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
N/A
Physical Location & Seq
Forward (+)
2333585 .. 2333913
329 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 189 bp
ATGTTAATACACCCTCGCCACTACTGTGTGAAGCTTTGCGTAACTACTAGGCGAATTTTCTGTAGTCGACAGAGAGCAAACAAACGAGCATCAATGGCTGAACCCAAAACCAAATACGATCGCCAGCTCAGAATCTGGGGCGAGCAAGGGCAGACAGCCCTGAAGAGAAGGCCAGCATATGCCTACTGA

Protein Analysis

63

Amino Acids

7.45

Weight (kDa)

10.72

Isoelectric Point (pI)

76.53

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 67
AcsI RAATTY 1 cut(s) 54
AcuI CTGAAG 1 cut(s) 182
AleI CACNNNNGTG 1 cut(s) 24
AluBI AGCT 2 cut(s) 34, 127
AluI AGCT 2 cut(s) 34, 127
AlwNI CAGNNNCTG 1 cut(s) 135
AoxI GGCC 1 cut(s) 170
ApoI RAATTY 1 cut(s) 54
BfaI CTAG 1 cut(s) 48
BfmI CTRYAG 1 cut(s) 61
BmsI GCATC 1 cut(s) 98
BseMII CTCAG 1 cut(s) 142
Bsh1285I CGRYCG 1 cut(s) 121
BshFI GGCC 1 cut(s) 172
BsiEI CGRYCG 1 cut(s) 121
BsnI GGCC 1 cut(s) 172
Bsp143I GATC 1 cut(s) 118
BspANI GGCC 1 cut(s) 172
BspCNI CTCAG 1 cut(s) 141
BssMI GATC 1 cut(s) 118
Bst4CI ACNGT 1 cut(s) 26
Bst6I CTCTTC 1 cut(s) 158
BstC8I GCNNGC 3 cut(s) 125, 143, 174
BstDEI CTNAG 1 cut(s) 128
BstKTI GATC 1 cut(s) 121
BstMBI GATC 1 cut(s) 118
BstMCI CGRYCG 1 cut(s) 121
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstSFI CTRYAG 1 cut(s) 61
BsuRI GGCC 1 cut(s) 172
Cac8I GCNNGC 3 cut(s) 125, 143, 174
CaiI CAGNNNCTG 1 cut(s) 135
CviJI RGCY 5 cut(s) 34, 98, 127, 158, 172
CviKI_1 RGCY 5 cut(s) 34, 98, 127, 158, 172
DdeI CTNAG 1 cut(s) 128
DpnI GATC 1 cut(s) 120
DpnII GATC 1 cut(s) 118
Eam1104I CTCTTC 1 cut(s) 158
EarI CTCTTC 1 cut(s) 158
Eco57I CTGAAG 1 cut(s) 182
FaiI YATR 2 cut(s) 178, 180
FauNDI CATATG 1 cut(s) 178
FblI GTMKAC 1 cut(s) 67
FspBI CTAG 1 cut(s) 48
HaeIII GGCC 1 cut(s) 172
HincII GTYRAC 1 cut(s) 68
HindII GTYRAC 1 cut(s) 68
HindIII AAGCTT 1 cut(s) 32
HinfI GANTC 1 cut(s) 132
Hpy166II GTNNAC 1 cut(s) 68
Hpy188I TCNGA 1 cut(s) 131
Hpy8I GTNNAC 1 cut(s) 68
HpyAV CCTTC 1 cut(s) 162
HpyCH4III ACNGT 1 cut(s) 26
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 128
Kzo9I GATC 1 cut(s) 118
LpnPI CCDG 3 cut(s) 121, 137, 173
LweI GCATC 1 cut(s) 98
MaeI CTAG 1 cut(s) 48
MaeIII GTNAC 1 cut(s) 40
MalI GATC 1 cut(s) 120
MboI GATC 1 cut(s) 118
MboII GAAGA 1 cut(s) 175
MluCI AATT 1 cut(s) 54
MnlI CCTC 1 cut(s) 24
MseI TTAA 1 cut(s) 5
MslI CAYNNNNRTG 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeI CATATG 1 cut(s) 178
NdeII GATC 1 cut(s) 118
OliI CACNNNNGTG 1 cut(s) 24
PfeI GAWTC 1 cut(s) 132
Ple19I CGATCG 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 135
PvuI CGATCG 1 cut(s) 121
RseI CAYNNNNRTG 1 cut(s) 24
SalI GTCGAC 1 cut(s) 66
SaqAI TTAA 1 cut(s) 5
Sau3AI GATC 1 cut(s) 118
SetI ASST 2 cut(s) 36, 129
SfaNI GCATC 1 cut(s) 98
SfcI CTRYAG 1 cut(s) 61
SgeI CNNG 9 cut(s) 27, 60, 98, 136, 148, 154, 158, 172, 185
SmiMI CAYNNNNRTG 1 cut(s) 24
Sse9I AATT 1 cut(s) 54
SspMI CTAG 1 cut(s) 48
TaaI ACNGT 1 cut(s) 26
TaqI TCGA 1 cut(s) 67
TasI AATT 1 cut(s) 54
TfiI GAWTC 1 cut(s) 132
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
XapI RAATTY 1 cut(s) 54
XmiI GTMKAC 1 cut(s) 67
XspI CTAG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.