pycom09g04890

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
N/A
Physical Location & Seq
Forward (+)
3625860 .. 3626114
255 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 255 bp
ATGGACAAATTCCTAATTCGTCAGTTTTCGAGTTTGCCCAATTCGATTCCGAAAGAACCCACCGTTACAAACCCCACAATTTCTGGGAAATTGGGGAAAATGAATCGGAATCCAATTCATATACCCCACAGAACGATCCCTTTAACCAAAGGGCAGGACCTTGATTTGCGTAGAGCTGATGTTGCTTTGGCGTTCTATAGAGAAATGCGGCGTTGTAGGATTTCGCCAGATGTTTACACTGGCAATAGCATGTAA

Protein Analysis

85

Amino Acids

9.62

Weight (kDa)

10.35

Isoelectric Point (pI)

39.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 208
AclWI GGATC 1 cut(s) 130
AcsI RAATTY 1 cut(s) 8
AluBI AGCT 1 cut(s) 176
AluI AGCT 1 cut(s) 176
AlwI GGATC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 157
AvaII GGWCC 1 cut(s) 157
BfmI CTRYAG 1 cut(s) 196
BisI GCNGC 1 cut(s) 209
BlsI GCNGC 1 cut(s) 210
Bme18I GGWCC 1 cut(s) 157
BmgT120I GGNCC 1 cut(s) 157
Bse1I ACTGG 1 cut(s) 244
BseNI ACTGG 1 cut(s) 244
Bsp143I GATC 1 cut(s) 135
BspACI CCGC 1 cut(s) 208
BspPI GGATC 1 cut(s) 130
BsrI ACTGG 1 cut(s) 244
BssMI GATC 1 cut(s) 135
Bst4CI ACNGT 1 cut(s) 64
BstKTI GATC 1 cut(s) 138
BstMBI GATC 1 cut(s) 135
BstMWI GCNNNNNNNGC 1 cut(s) 182
BstNSI RCATGY 1 cut(s) 253
BstSFI CTRYAG 1 cut(s) 196
BtsIMutI CAGTG 1 cut(s) 237
Cfr13I GGNCC 1 cut(s) 157
CviAII CATG 1 cut(s) 250
CviJI RGCY 1 cut(s) 176
CviKI_1 RGCY 1 cut(s) 176
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
Eco47I GGWCC 1 cut(s) 157
EcoO109I RGGNCCY 1 cut(s) 157
FaeI CATG 1 cut(s) 253
FaiI YATR 4 cut(s) 120, 122, 198, 251
FatI CATG 1 cut(s) 249
Fnu4HI GCNGC 1 cut(s) 209
Fsp4HI GCNGC 1 cut(s) 209
GluI GCNGC 1 cut(s) 209
Hin1II CATG 1 cut(s) 253
HinfI GANTC 3 cut(s) 46, 103, 109
Hpy166II GTNNAC 1 cut(s) 235
Hpy188I TCNGA 2 cut(s) 51, 108
Hpy8I GTNNAC 1 cut(s) 235
HpyCH4III ACNGT 1 cut(s) 64
HpyF10VI GCNNNNNNNGC 1 cut(s) 182
Hsp92II CATG 1 cut(s) 253
Kzo9I GATC 1 cut(s) 135
LpnPI CCDG 4 cut(s) 69, 140, 225, 240
MaeIII GTNAC 1 cut(s) 64
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MluCI AATT 6 cut(s) 8, 15, 40, 78, 89, 114
MseI TTAA 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 182
NdeII GATC 1 cut(s) 135
NlaIII CATG 1 cut(s) 253
NspI RCATGY 1 cut(s) 253
PfeI GAWTC 3 cut(s) 46, 103, 109
PkrI GCNGC 1 cut(s) 210
PpuMI RGGWCCY 1 cut(s) 157
Psp5II RGGWCCY 1 cut(s) 157
PspPI GGNCC 1 cut(s) 157
PspPPI RGGWCCY 1 cut(s) 157
SaqAI TTAA 1 cut(s) 143
SatI GCNGC 1 cut(s) 209
Sau3AI GATC 1 cut(s) 135
Sau96I GGNCC 1 cut(s) 157
SetI ASST 2 cut(s) 162, 178
SfcI CTRYAG 1 cut(s) 196
SgeI CNNG 5 cut(s) 42, 96, 167, 173, 239
SinI GGWCC 1 cut(s) 157
Sse9I AATT 6 cut(s) 8, 15, 40, 78, 89, 114
SsiI CCGC 1 cut(s) 208
TaaI ACNGT 1 cut(s) 64
TaqI TCGA 2 cut(s) 29, 44
TasI AATT 6 cut(s) 8, 15, 40, 78, 89, 114
TauI GCSGC 1 cut(s) 211
TfiI GAWTC 3 cut(s) 46, 103, 109
Tru1I TTAA 1 cut(s) 143
Tru9I TTAA 1 cut(s) 143
TscAI CASTG 1 cut(s) 244
TspDTI ATGAA 2 cut(s) 107, 116
TspRI CASTG 1 cut(s) 244
VpaK11BI GGWCC 1 cut(s) 157
XapI RAATTY 1 cut(s) 8
XceI RCATGY 1 cut(s) 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.