pycom09g08350

Auxin responsive protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
N/A
Physical Location & Seq
Forward (+)
6416383 .. 6416647
265 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 225 bp
ATGGATTCAAAGAAGTCTAACAAGATTAGGGAGATTGTTAGGCTCCACTTCTTTAGGATAGATCTTAAAGAAGTGGAAAAAGCTACAGCTTATAGCATAATTAATAATGCCAATAGCACCACCACTAGTACTAGCAGCAGCAGAAGCATGAAGTTCTTCAAGAGAACACTCTCTTTCTCAGATGTTTTATTGGATGTCATTATTAAAAATAGGGTTAAATATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.62

Weight (kDa)

10.23

Isoelectric Point (pI)

28.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 130
AgsI TTSAA 2 cut(s) 9, 160
AhlI ACTAGT 1 cut(s) 125
AluBI AGCT 2 cut(s) 83, 89
AluI AGCT 2 cut(s) 83, 89
ApeKI GCWGC 2 cut(s) 135, 138
AseI ATTAAT 1 cut(s) 102
Asp700I GAANNNNTTC 1 cut(s) 155
BbvI GCAGC 2 cut(s) 147, 150
BcuI ACTAGT 1 cut(s) 125
BfaI CTAG 2 cut(s) 126, 132
BfmI CTRYAG 1 cut(s) 84
BglII AGATCT 1 cut(s) 61
BisI GCNGC 2 cut(s) 136, 139
BlsI GCNGC 2 cut(s) 137, 140
BmcAI AGTACT 1 cut(s) 130
BmiI GGNNCC 1 cut(s) 44
BseGI GGATG 1 cut(s) 199
BseMII CTCAG 1 cut(s) 192
BseXI GCAGC 2 cut(s) 147, 150
Bsp143I GATC 1 cut(s) 61
BspCNI CTCAG 1 cut(s) 191
BspLI GGNNCC 1 cut(s) 44
BssMI GATC 1 cut(s) 61
BstDEI CTNAG 1 cut(s) 178
BstF5I GGATG 1 cut(s) 199
BstKTI GATC 1 cut(s) 64
BstMBI GATC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstSFI CTRYAG 1 cut(s) 84
BstV1I GCAGC 2 cut(s) 147, 150
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
BtsCI GGATG 1 cut(s) 199
Csp6I GTAC 1 cut(s) 129
CviAII CATG 1 cut(s) 148
CviJI RGCY 3 cut(s) 43, 83, 89
CviKI_1 RGCY 3 cut(s) 43, 83, 89
CviQI GTAC 1 cut(s) 129
DdeI CTNAG 1 cut(s) 178
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
FaeI CATG 1 cut(s) 151
FaiI YATR 3 cut(s) 93, 98, 149
FatI CATG 1 cut(s) 147
Fnu4HI GCNGC 2 cut(s) 136, 139
FokI GGATG 1 cut(s) 206
Fsp4HI GCNGC 2 cut(s) 136, 139
FspBI CTAG 2 cut(s) 126, 132
GluI GCNGC 2 cut(s) 136, 139
Hin1II CATG 1 cut(s) 151
HinfI GANTC 1 cut(s) 5
Hpy188I TCNGA 1 cut(s) 181
Hpy188III TCNNGA 1 cut(s) 160
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
HpyF3I CTNAG 1 cut(s) 178
Hsp92II CATG 1 cut(s) 151
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 1 cut(s) 48
Lsp1109I GCAGC 2 cut(s) 147, 150
MaeI CTAG 2 cut(s) 126, 132
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 148
MflI RGATCY 1 cut(s) 61
MluCI AATT 1 cut(s) 99
MroXI GAANNNNTTC 1 cut(s) 155
MseI TTAA 4 cut(s) 66, 102, 204, 216
MwoI GCNNNNNNNGC 1 cut(s) 144
NdeII GATC 1 cut(s) 61
NlaIII CATG 1 cut(s) 151
NlaIV GGNNCC 1 cut(s) 44
PdmI GAANNNNTTC 1 cut(s) 155
PfeI GAWTC 1 cut(s) 5
PkrI GCNGC 2 cut(s) 137, 140
PshBI ATTAAT 1 cut(s) 102
PspN4I GGNNCC 1 cut(s) 44
PsuI RGATCY 1 cut(s) 61
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SaqAI TTAA 4 cut(s) 66, 102, 204, 216
SatI GCNGC 2 cut(s) 136, 139
Sau3AI GATC 1 cut(s) 61
ScaI AGTACT 1 cut(s) 130
SetI ASST 2 cut(s) 85, 91
SfcI CTRYAG 1 cut(s) 84
SgeI CNNG 5 cut(s) 34, 138, 144, 160, 172
SpeI ACTAGT 1 cut(s) 125
Sse9I AATT 1 cut(s) 99
SspI AATATT 1 cut(s) 221
SspMI CTAG 2 cut(s) 126, 132
TasI AATT 1 cut(s) 99
TatI WGTACW 1 cut(s) 128
TfiI GAWTC 1 cut(s) 5
Tru1I TTAA 4 cut(s) 66, 102, 204, 216
Tru9I TTAA 4 cut(s) 66, 102, 204, 216
TseI GCWGC 2 cut(s) 135, 138
TspDTI ATGAA 1 cut(s) 164
VspI ATTAAT 1 cut(s) 102
XmnI GAANNNNTTC 1 cut(s) 155
XspI CTAG 2 cut(s) 126, 132
ZrmI AGTACT 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.