pycom09g11620

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
N/A
Physical Location & Seq
Forward (+)
9824959 .. 9825156
198 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 198 bp
ATGAGAAAAGCAATATCTATAGCTTTGGGGTTGTGCTGTTGGAGATTATCACTAGTAAACATGTTTTTATCAAAAACACATGATCACATTAGTGCTTGGGTTGCTTTCTTGCTTGAAAAGGGGACATTAACGGGATCTTTGATTCGAGATTCGACACGAACTTCAAGGTTAGCTTTGACTGGAAAGCTTTGGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

66

Amino Acids

7.32

Weight (kDa)

10.54

Isoelectric Point (pI)

19.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 142
AflIII ACRYGT 1 cut(s) 60
AgsI TTSAA 2 cut(s) 116, 165
AhlI ACTAGT 1 cut(s) 52
AleI CACNNNNGTG 1 cut(s) 90
AluBI AGCT 3 cut(s) 23, 173, 187
AluI AGCT 3 cut(s) 23, 173, 187
AlwI GGATC 1 cut(s) 142
BclI TGATCA 1 cut(s) 82
BcuI ACTAGT 1 cut(s) 52
BfaI CTAG 1 cut(s) 53
BfmI CTRYAG 1 cut(s) 18
Bse1I ACTGG 1 cut(s) 184
BseNI ACTGG 1 cut(s) 184
BslFI GGGAC 1 cut(s) 136
BsmFI GGGAC 1 cut(s) 136
Bsp143I GATC 2 cut(s) 82, 134
BspPI GGATC 1 cut(s) 142
BsrI ACTGG 1 cut(s) 184
BssMI GATC 2 cut(s) 82, 134
BstKTI GATC 2 cut(s) 85, 137
BstMBI GATC 2 cut(s) 82, 134
BstMWI GCNNNNNNNGC 1 cut(s) 101
BstNSI RCATGY 1 cut(s) 64
BstSFI CTRYAG 1 cut(s) 18
BstX2I RGATCY 1 cut(s) 134
BstYI RGATCY 1 cut(s) 134
CviAII CATG 2 cut(s) 61, 80
CviJI RGCY 3 cut(s) 23, 173, 187
CviKI_1 RGCY 3 cut(s) 23, 173, 187
DpnI GATC 2 cut(s) 84, 136
DpnII GATC 2 cut(s) 82, 134
FaeI CATG 2 cut(s) 64, 83
FaiI YATR 3 cut(s) 20, 62, 81
FalI AAGNNNNNCTT 2 cut(s) 157, 189
FaqI GGGAC 1 cut(s) 136
FatI CATG 2 cut(s) 60, 79
FbaI TGATCA 1 cut(s) 82
FspBI CTAG 1 cut(s) 53
Hin1II CATG 2 cut(s) 64, 83
HindIII AAGCTT 1 cut(s) 185
HinfI GANTC 2 cut(s) 142, 149
Hpy166II GTNNAC 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 146
Hpy8I GTNNAC 1 cut(s) 58
HpyF10VI GCNNNNNNNGC 1 cut(s) 101
Hsp92II CATG 2 cut(s) 64, 83
Ksp22I TGATCA 1 cut(s) 82
Kzo9I GATC 2 cut(s) 82, 134
LpnPI CCDG 1 cut(s) 165
MaeI CTAG 1 cut(s) 53
MalI GATC 2 cut(s) 84, 136
MboI GATC 2 cut(s) 82, 134
MflI RGATCY 1 cut(s) 134
MmeI TCCRAC 1 cut(s) 20
MseI TTAA 1 cut(s) 128
MslI CAYNNNNRTG 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 101
NdeII GATC 2 cut(s) 82, 134
NlaIII CATG 2 cut(s) 64, 83
NspI RCATGY 1 cut(s) 64
OliI CACNNNNGTG 1 cut(s) 90
PciI ACATGT 1 cut(s) 60
PfeI GAWTC 2 cut(s) 142, 149
PscI ACATGT 1 cut(s) 60
PsuI RGATCY 1 cut(s) 134
RseI CAYNNNNRTG 1 cut(s) 90
SaqAI TTAA 1 cut(s) 128
Sau3AI GATC 2 cut(s) 82, 134
SetI ASST 4 cut(s) 25, 170, 175, 189
SfcI CTRYAG 1 cut(s) 18
SmiMI CAYNNNNRTG 1 cut(s) 90
SpeI ACTAGT 1 cut(s) 52
SspMI CTAG 1 cut(s) 53
TaqI TCGA 2 cut(s) 145, 152
TfiI GAWTC 2 cut(s) 142, 149
Tru1I TTAA 1 cut(s) 128
Tru9I TTAA 1 cut(s) 128
XceI RCATGY 1 cut(s) 64
XspI CTAG 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.