pycom09g12480

Malonate--CoA

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
N/A
Physical Location & Seq
Reverse (-)
11044440 .. 11044661
222 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGGCAATATCAAACCCCTTAAGAGGTGAGCGGAAAGCAGGCACGGTAGGAAAACCATTTCCGGCTGTGGAGGTGAGTGGGCTACAGTTTGCAACATATACTTCTGGTAGCAGTTTAACTTTTGAAAGCCTTGTGAAGGAAGCTTTTGCTTATACAGAATTTTTAATAGTGGCCCTTGAACTGAAGGAAACCACTGATAATAGCGAAATCATGAGCATTTAA

Protein Analysis

74

Amino Acids

7.89

Weight (kDa)

4.73

Isoelectric Point (pI)

34.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 31
AciI CCGC 1 cut(s) 31
AcsI RAATTY 1 cut(s) 158
AcuI CTGAAG 1 cut(s) 203
AfiI CCNNNNNNNGG 2 cut(s) 23, 136
AflII CTTAAG 1 cut(s) 19
AgsI TTSAA 2 cut(s) 125, 179
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AoxI GGCC 1 cut(s) 171
ApoI RAATTY 1 cut(s) 158
AspS9I GGNCC 1 cut(s) 172
AsuHPI GGTGA 2 cut(s) 38, 85
BfmI CTRYAG 1 cut(s) 83
BfrI CTTAAG 1 cut(s) 19
BmgT120I GGNCC 1 cut(s) 172
Bsc4I CCNNNNNNNGG 2 cut(s) 23, 136
BseLI CCNNNNNNNGG 2 cut(s) 23, 136
BshFI GGCC 1 cut(s) 173
BsiSI CCGG 1 cut(s) 62
BslI CCNNNNNNNGG 2 cut(s) 23, 136
BsnI GGCC 1 cut(s) 173
BspACI CCGC 1 cut(s) 31
BspANI GGCC 1 cut(s) 173
BspHI TCATGA 1 cut(s) 210
BspTI CTTAAG 1 cut(s) 19
BsrBI CCGCTC 1 cut(s) 31
Bst4CI ACNGT 2 cut(s) 46, 87
BstAFI CTTAAG 1 cut(s) 19
BstC8I GCNNGC 1 cut(s) 40
BstENI CCTNNNNNAGG 1 cut(s) 134
BstSFI CTRYAG 1 cut(s) 83
BsuRI GGCC 1 cut(s) 173
BtsIMutI CAGTG 1 cut(s) 192
Cac8I GCNNGC 1 cut(s) 40
CciI TCATGA 1 cut(s) 210
Cfr13I GGNCC 1 cut(s) 172
CviAII CATG 1 cut(s) 211
CviJI RGCY 5 cut(s) 65, 82, 129, 143, 173
CviKI_1 RGCY 5 cut(s) 65, 82, 129, 143, 173
Eco57I CTGAAG 1 cut(s) 203
EcoNI CCTNNNNNAGG 1 cut(s) 134
FaeI CATG 1 cut(s) 214
FaiI YATR 4 cut(s) 97, 99, 153, 212
FatI CATG 1 cut(s) 210
HaeIII GGCC 1 cut(s) 173
HapII CCGG 1 cut(s) 62
Hin1II CATG 1 cut(s) 214
HindIII AAGCTT 1 cut(s) 141
HpaII CCGG 1 cut(s) 62
HphI GGTGA 2 cut(s) 38, 85
Hpy188III TCNNGA 1 cut(s) 211
HpyAV CCTTC 2 cut(s) 130, 178
HpyCH4III ACNGT 2 cut(s) 46, 87
HpyCH4V TGCA 1 cut(s) 92
Hsp92II CATG 1 cut(s) 214
LpnPI CCDG 3 cut(s) 24, 75, 90
MbiI CCGCTC 1 cut(s) 31
MluCI AATT 1 cut(s) 158
MnlI CCTC 2 cut(s) 17, 64
MseI TTAA 4 cut(s) 20, 116, 164, 220
MspCI CTTAAG 1 cut(s) 19
MspI CCGG 1 cut(s) 62
NlaIII CATG 1 cut(s) 214
PagI TCATGA 1 cut(s) 210
PspPI GGNCC 1 cut(s) 172
SaqAI TTAA 4 cut(s) 20, 116, 164, 220
Sau96I GGNCC 1 cut(s) 172
SetI ASST 3 cut(s) 28, 75, 145
SfcI CTRYAG 1 cut(s) 83
SgeI CNNG 6 cut(s) 51, 55, 74, 117, 143, 188
SmlI CTYRAG 1 cut(s) 19
SmoI CTYRAG 1 cut(s) 19
Sse9I AATT 1 cut(s) 158
SsiI CCGC 1 cut(s) 31
TaaI ACNGT 2 cut(s) 46, 87
TasI AATT 1 cut(s) 158
Tru1I TTAA 4 cut(s) 20, 116, 164, 220
Tru9I TTAA 4 cut(s) 20, 116, 164, 220
TscAI CASTG 1 cut(s) 199
TspRI CASTG 1 cut(s) 199
Vha464I CTTAAG 1 cut(s) 19
XagI CCTNNNNNAGG 1 cut(s) 134
XapI RAATTY 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.