pycom09g16610

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr9
N/A
Physical Location & Seq
Reverse (-)
16924733 .. 16925256
524 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 468 bp
ATGAGTGGTCCCATGAAAATTGAGTGGCCCCCAAGGAGGTGTCCACATTTCAAATGTCGATTAAAATTTAAAGGCCACAGATGTCACATACCAGCTCATCCTTATTCTTATCTCATTTCCGCCACGTGTGCATGTGGGTTGGCCCACGCGGTTCCTTCCATTTTAAAATACGCGACCGCATCCACCACACAAAAACAGCAGCTCCTCTTCCAGCAGCAGCAGCGCCATAATTCCCCCGATAAAACCCCCCACACCAACCCCACTCTCTACTCTCTTTCTGTTCTCTTTCTCTCTCCAAAACTTTTGGTGGTTTCTCTCTCTAGAAAGCAGAAACAAAGAATGGCAGGGTTTGAGAACCAGGTGAGGCAGAGGGCCAGGGAGCTGAAACACTTGGTGAAGAAAGGAGTGAGGATCGTTGGAAATTCGTGCAAGAAGGGCTGGTTCAAGATTAAGCACATCAGAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

156

Amino Acids

17.79

Weight (kDa)

10.7

Isoelectric Point (pI)

44.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes

No orthologs found for this gene in the current database.

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 149, 173
AciI CCGC 3 cut(s) 120, 149, 177
AclWI GGATC 1 cut(s) 419
AcsI RAATTY 2 cut(s) 65, 421
AcvI CACGTG 1 cut(s) 126
AdeI CACNNNGTG 1 cut(s) 394
AfiI CCNNNNNNNGG 1 cut(s) 36
AflIII ACRYGT 1 cut(s) 125
AgsI TTSAA 2 cut(s) 52, 445
AjnI CCWGG 2 cut(s) 357, 374
AluBI AGCT 3 cut(s) 95, 202, 382
AluI AGCT 3 cut(s) 95, 202, 382
AlwI GGATC 1 cut(s) 419
AlwNI CAGNNNCTG 1 cut(s) 465
AoxI GGCC 4 cut(s) 26, 73, 141, 372
ApeKI GCWGC 4 cut(s) 199, 214, 217, 220
ApoI RAATTY 2 cut(s) 65, 421
AspLEI GCGC 1 cut(s) 225
AspS9I GGNCC 4 cut(s) 8, 27, 142, 372
AsuHPI GGTGA 2 cut(s) 373, 406
AvaII GGWCC 1 cut(s) 8
BbrPI CACGTG 1 cut(s) 126
BbvI GCAGC 4 cut(s) 211, 226, 229, 232
BciT130I CCWGG 2 cut(s) 359, 376
BfaI CTAG 1 cut(s) 321
BfoI RGCGCY 1 cut(s) 226
BisI GCNGC 4 cut(s) 200, 215, 218, 221
BlsI GCNGC 4 cut(s) 201, 216, 219, 222
Bme1390I CCNGG 2 cut(s) 359, 376
Bme18I GGWCC 1 cut(s) 8
BmgT120I GGNCC 4 cut(s) 8, 27, 142, 372
BmiI GGNNCC 3 cut(s) 10, 29, 153
BmrFI CCNGG 2 cut(s) 359, 376
BmsI GCATC 1 cut(s) 188
BsaAI YACGTR 1 cut(s) 126
BsaJI CCNNGG 2 cut(s) 32, 375
BsaXI ACNNNNNCTCC 2 cut(s) 186, 216
Bsc4I CCNNNNNNNGG 1 cut(s) 36
BseBI CCWGG 2 cut(s) 359, 376
BseDI CCNNGG 2 cut(s) 32, 375
BseGI GGATG 2 cut(s) 97, 179
BseLI CCNNNNNNNGG 1 cut(s) 36
BseRI GAGGAG 1 cut(s) 194
BseXI GCAGC 4 cut(s) 211, 226, 229, 232
Bsh1236I CGCG 2 cut(s) 149, 173
Bsh1285I CGRYCG 1 cut(s) 177
BshFI GGCC 4 cut(s) 28, 75, 143, 374
BsiEI CGRYCG 1 cut(s) 177
BslI CCNNNNNNNGG 1 cut(s) 36
BsnI GGCC 4 cut(s) 28, 75, 143, 374
Bsp143I GATC 1 cut(s) 411
BspACI CCGC 3 cut(s) 120, 149, 177
BspANI GGCC 4 cut(s) 28, 75, 143, 374
BspFNI CGCG 2 cut(s) 149, 173
BspLI GGNNCC 3 cut(s) 10, 29, 153
BspPI GGATC 1 cut(s) 419
BssECI CCNNGG 2 cut(s) 32, 375
BssMI GATC 1 cut(s) 411
BssT1I CCWWGG 1 cut(s) 32
Bst2UI CCWGG 2 cut(s) 359, 376
Bst6I CTCTTC 1 cut(s) 212
BstBAI YACGTR 1 cut(s) 126
BstF5I GGATG 2 cut(s) 97, 179
BstFNI CGCG 2 cut(s) 149, 173
BstH2I RGCGCY 1 cut(s) 226
BstHHI GCGC 1 cut(s) 225
BstKTI GATC 1 cut(s) 414
BstMBI GATC 1 cut(s) 411
BstMCI CGRYCG 1 cut(s) 177
BstMWI GCNNNNNNNGC 3 cut(s) 128, 220, 435
BstNI CCWGG 2 cut(s) 359, 376
BstNSI RCATGY 1 cut(s) 135
BstSCI CCNGG 2 cut(s) 357, 374
BstUI CGCG 2 cut(s) 149, 173
BstV1I GCAGC 4 cut(s) 211, 226, 229, 232
BsuRI GGCC 4 cut(s) 28, 75, 143, 374
BtsCI GGATG 2 cut(s) 97, 179
CaiI CAGNNNCTG 1 cut(s) 465
CfoI GCGC 1 cut(s) 225
Cfr13I GGNCC 4 cut(s) 8, 27, 142, 372
CsiI ACCWGGT 1 cut(s) 357
CviAII CATG 2 cut(s) 13, 132
CviJI RGCY 9 cut(s) 28, 75, 95, 143, 202, 374, 382, 438, 465
CviKI_1 RGCY 9 cut(s) 28, 75, 95, 143, 202, 374, 382, 438, 465
DpnI GATC 1 cut(s) 413
DpnII GATC 1 cut(s) 411
DraI TTTAAA 2 cut(s) 70, 165
DraIII CACNNNGTG 1 cut(s) 394
Eam1104I CTCTTC 1 cut(s) 212
EarI CTCTTC 1 cut(s) 212
EciI GGCGGA 1 cut(s) 109
Eco130I CCWWGG 1 cut(s) 32
Eco47I GGWCC 1 cut(s) 8
Eco72I CACGTG 1 cut(s) 126
EcoRII CCWGG 2 cut(s) 357, 374
EcoT14I CCWWGG 1 cut(s) 32
ErhI CCWWGG 1 cut(s) 32
FaeI CATG 2 cut(s) 16, 135
FaiI YATR 4 cut(s) 14, 89, 133, 228
FatI CATG 2 cut(s) 12, 131
Fnu4HI GCNGC 4 cut(s) 200, 215, 218, 221
FokI GGATG 2 cut(s) 84, 166
Fsp4HI GCNGC 4 cut(s) 200, 215, 218, 221
FspBI CTAG 1 cut(s) 321
GlaI GCGC 1 cut(s) 224
GluI GCNGC 4 cut(s) 200, 215, 218, 221
HaeII RGCGCY 1 cut(s) 226
HaeIII GGCC 4 cut(s) 28, 75, 143, 374
HhaI GCGC 1 cut(s) 225
Hin1II CATG 2 cut(s) 16, 135
Hin6I GCGC 1 cut(s) 223
HinP1I GCGC 1 cut(s) 223
HphI GGTGA 2 cut(s) 373, 406
Hpy166II GTNNAC 1 cut(s) 44
Hpy188I TCNGA 1 cut(s) 461
Hpy188III TCNNGA 2 cut(s) 321, 445
Hpy8I GTNNAC 1 cut(s) 44
HpyAV CCTTC 2 cut(s) 165, 427
HpyCH4IV ACGT 1 cut(s) 125
HpyCH4V TGCA 2 cut(s) 131, 429
HpyF10VI GCNNNNNNNGC 3 cut(s) 128, 220, 435
HpySE526I ACGT 1 cut(s) 125
Hsp92II CATG 2 cut(s) 16, 135
HspAI GCGC 1 cut(s) 223
Kzo9I GATC 1 cut(s) 411
LmnI GCTCC 2 cut(s) 207, 379
LpnPI CCDG 8 cut(s) 105, 224, 330, 344, 361, 371, 388, 424
Lsp1109I GCAGC 4 cut(s) 211, 226, 229, 232
LweI GCATC 1 cut(s) 188
MabI ACCWGGT 1 cut(s) 357
MaeI CTAG 1 cut(s) 321
MaeII ACGT 1 cut(s) 125
MaeIII GTNAC 1 cut(s) 83
MalI GATC 1 cut(s) 413
MboI GATC 1 cut(s) 411
MboII GAAGA 2 cut(s) 199, 409
MluCI AATT 4 cut(s) 18, 65, 229, 421
MmeI TCCRAC 1 cut(s) 397
MnlI CCTC 6 cut(s) 30, 215, 357, 363, 402, 455
MseI TTAA 4 cut(s) 62, 69, 164, 450
MspR9I CCNGG 2 cut(s) 359, 376
MvaI CCWGG 2 cut(s) 359, 376
MvnI CGCG 2 cut(s) 149, 173
MwoI GCNNNNNNNGC 3 cut(s) 128, 220, 435
NdeII GATC 1 cut(s) 411
NlaIII CATG 2 cut(s) 16, 135
NlaIV GGNNCC 3 cut(s) 10, 29, 153
NmuCI GTSAC 1 cut(s) 83
NspI RCATGY 1 cut(s) 135
PkrI GCNGC 4 cut(s) 201, 216, 219, 222
PmaCI CACGTG 1 cut(s) 126
PmlI CACGTG 1 cut(s) 126
Ppu21I YACGTR 1 cut(s) 126
Psp6I CCWGG 2 cut(s) 357, 374
PspCI CACGTG 1 cut(s) 126
PspGI CCWGG 2 cut(s) 357, 374
PspN4I GGNNCC 3 cut(s) 10, 29, 153
PspPI GGNCC 4 cut(s) 8, 27, 142, 372
PstNI CAGNNNCTG 1 cut(s) 465
SaqAI TTAA 4 cut(s) 62, 69, 164, 450
SatI GCNGC 4 cut(s) 200, 215, 218, 221
Sau3AI GATC 1 cut(s) 411
Sau96I GGNCC 4 cut(s) 8, 27, 142, 372
ScrFI CCNGG 2 cut(s) 359, 376
SetI ASST 6 cut(s) 41, 97, 128, 204, 363, 384
SexAI ACCWGGT 1 cut(s) 357
SfaNI GCATC 1 cut(s) 188
SinI GGWCC 1 cut(s) 8
Sse9I AATT 4 cut(s) 18, 65, 229, 421
SsiI CCGC 3 cut(s) 120, 149, 177
SspMI CTAG 1 cut(s) 321
StyD4I CCNGG 2 cut(s) 357, 374
StyI CCWWGG 1 cut(s) 32
TaiI ACGT 1 cut(s) 128
TaqI TCGA 1 cut(s) 58
TasI AATT 4 cut(s) 18, 65, 229, 421
Tru1I TTAA 4 cut(s) 62, 69, 164, 450
Tru9I TTAA 4 cut(s) 62, 69, 164, 450
TseFI GTSAC 1 cut(s) 83
TseI GCWGC 4 cut(s) 199, 214, 217, 220
Tsp45I GTSAC 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 29
VpaK11BI GGWCC 1 cut(s) 8
XapI RAATTY 2 cut(s) 65, 421
XbaI TCTAGA 1 cut(s) 320
XceI RCATGY 1 cut(s) 135
XspI CTAG 1 cut(s) 321
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.